ID: 1072021861

View in Genome Browser
Species Human (GRCh38)
Location 10:91410409-91410431
Sequence CGGGCGGCGGGAGCGCCAGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 374}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072021861_1072021878 30 Left 1072021861 10:91410409-91410431 CCGCCTGGCGCTCCCGCCGCCCG 0: 1
1: 0
2: 3
3: 27
4: 374
Right 1072021878 10:91410462-91410484 CTCGCCCGCCACTCCGCTGGTGG 0: 1
1: 0
2: 0
3: 5
4: 67
1072021861_1072021874 3 Left 1072021861 10:91410409-91410431 CCGCCTGGCGCTCCCGCCGCCCG 0: 1
1: 0
2: 3
3: 27
4: 374
Right 1072021874 10:91410435-91410457 CGACATGAGTGAGGCGGTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 29
1072021861_1072021870 -3 Left 1072021861 10:91410409-91410431 CCGCCTGGCGCTCCCGCCGCCCG 0: 1
1: 0
2: 3
3: 27
4: 374
Right 1072021870 10:91410429-91410451 CCGGCCCGACATGAGTGAGGCGG 0: 1
1: 0
2: 1
3: 3
4: 53
1072021861_1072021875 27 Left 1072021861 10:91410409-91410431 CCGCCTGGCGCTCCCGCCGCCCG 0: 1
1: 0
2: 3
3: 27
4: 374
Right 1072021875 10:91410459-91410481 ACCCTCGCCCGCCACTCCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 129
1072021861_1072021873 2 Left 1072021861 10:91410409-91410431 CCGCCTGGCGCTCCCGCCGCCCG 0: 1
1: 0
2: 3
3: 27
4: 374
Right 1072021873 10:91410434-91410456 CCGACATGAGTGAGGCGGTTCGG 0: 1
1: 0
2: 0
3: 5
4: 36
1072021861_1072021867 -6 Left 1072021861 10:91410409-91410431 CCGCCTGGCGCTCCCGCCGCCCG 0: 1
1: 0
2: 3
3: 27
4: 374
Right 1072021867 10:91410426-91410448 CGCCCGGCCCGACATGAGTGAGG 0: 1
1: 0
2: 0
3: 4
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072021861 Original CRISPR CGGGCGGCGGGAGCGCCAGG CGG (reversed) Exonic
900090287 1:917289-917311 ATGGAGGCGGGAGAGCCAGGAGG - Intergenic
900140396 1:1137249-1137271 CGTGGGGTGGGGGCGCCAGGGGG + Intergenic
900314591 1:2050555-2050577 CGCGGGGCGGGGGCTCCAGGTGG - Exonic
900671338 1:3856908-3856930 GGGGCCGCGGCAGCGCCAGTCGG - Exonic
900948306 1:5843671-5843693 AGGGCGTTGGGAGGGCCAGGGGG + Intergenic
901066630 1:6497424-6497446 CGGGAGGCGGGCGGGGCAGGTGG + Intronic
901067408 1:6500813-6500835 CGGGAGGTGGGGGAGCCAGGAGG - Intronic
901469951 1:9449355-9449377 CGGGTGGCGGGGGCGGGAGGGGG + Intergenic
901641369 1:10694688-10694710 CGCGCGGCGGGGGCGCGCGGCGG - Intronic
901676582 1:10889033-10889055 CGGGCTGCGGGCGCAGCAGGGGG + Intergenic
902315765 1:15617409-15617431 CGGGCGGCCGGCGCGCTTGGCGG + Intergenic
902451371 1:16498961-16498983 CGGGCCGGGGGCGCGACAGGAGG - Intergenic
904003416 1:27351008-27351030 GGGGCTGCGGGAGAGCCTGGTGG - Intronic
904045021 1:27603653-27603675 TGCGCGGCGGGAGGGCGAGGGGG - Intronic
904772140 1:32886442-32886464 CGCGCGGCAGGGGCGGCAGGAGG - Exonic
905990659 1:42334901-42334923 TGGGCGGCGGGTGGGGCAGGGGG - Intronic
906032416 1:42732311-42732333 GGGGCGGCGGGAGCGCTGGAGGG - Intergenic
906069688 1:43007714-43007736 GGGGCTGCGGCAGCTCCAGGCGG + Intergenic
906640511 1:47438224-47438246 TGGGCGGCGGCAGCGGCGGGGGG + Exonic
907010665 1:50960005-50960027 CGGGCGGCCGGGGCGCCTGAAGG - Exonic
912955560 1:114152649-114152671 CTGGCGGCGGGAGCTGCGGGAGG - Exonic
915272060 1:154760577-154760599 GGGGCGCAGGGAGGGCCAGGTGG - Intronic
916716949 1:167454827-167454849 GGGGCGGAGGGGGAGCCAGGAGG + Intronic
917755387 1:178093762-178093784 GCGGCGGCGGCAGCGGCAGGCGG - Intergenic
918265675 1:182839551-182839573 CGGGCGGCGGCGGCGGCTGGGGG + Intronic
923055884 1:230425899-230425921 AGGGCGGCGGGGGCGCGCGGAGG - Intergenic
923171685 1:231422349-231422371 GGGGCGGAGGGAGGGCCGGGAGG + Exonic
923631039 1:235649777-235649799 CGGGCGGCGGGAGGGGCACGAGG - Exonic
1064022790 10:11823301-11823323 CGGGCGGCGCGAGCGCGCGGCGG + Intergenic
1064222920 10:13456595-13456617 CGGGGGCCGGGAGAGCAAGGTGG + Intronic
1066464555 10:35640913-35640935 CGGGCGGCGGCGGCGGCAGGCGG + Exonic
1067769892 10:49115527-49115549 CTGGCGGCGGCCGGGCCAGGCGG - Intergenic
1069386058 10:67884566-67884588 TGGGTGGCGGGAGCGCCGAGAGG + Intergenic
1071858010 10:89645162-89645184 CGGGCGGCGGGAGCCCCGGCTGG - Exonic
1072021861 10:91410409-91410431 CGGGCGGCGGGAGCGCCAGGCGG - Exonic
1072294235 10:93994013-93994035 CGGGCGGCGGGCTCGCGCGGCGG + Intronic
1072638921 10:97196340-97196362 CCGGGGGAGGGAGCGCAAGGGGG + Intronic
1074087776 10:110221799-110221821 GGGGTGGGGGGAACGCCAGGGGG - Intronic
1074377144 10:112950107-112950129 CGGGCGCCGGGAGAGGGAGGAGG - Intergenic
1075370069 10:121928097-121928119 CGGGCGGCGTCAGCTCCAAGAGG - Intronic
1075587159 10:123666313-123666335 CGGGCGGCGGCGGCGCCGAGGGG + Intergenic
1075801849 10:125159414-125159436 CGGGCGGCGGGCGCGGGCGGGGG - Intronic
1076426655 10:130371913-130371935 CGGGCGGCTCGCGCGGCAGGGGG - Intergenic
1077063325 11:627041-627063 CGGGGGGCGGGCGGGCCTGGCGG + Intronic
1077105988 11:842885-842907 CGGGCGGCGCGAGCGGGAGGCGG + Intronic
1077266400 11:1652955-1652977 CGGGTGGAGGGAGCTGCAGGAGG + Intergenic
1077330334 11:1981389-1981411 GCGGCTGCGGGAGCCCCAGGGGG - Intronic
1078057134 11:8018179-8018201 CAGGAGGCTGGAGCGCGAGGAGG - Intergenic
1079237171 11:18699090-18699112 CGGGCTGGGGGCGCGCGAGGAGG - Intronic
1080012359 11:27472088-27472110 CGGGCGGCGGGGACGCGAGGGGG - Intronic
1080517779 11:33039748-33039770 TTCGCGGCGGGAGCGGCAGGAGG + Exonic
1080836277 11:35943986-35944008 CGGGAGGGAGGAGGGCCAGGCGG + Intronic
1083596486 11:63920363-63920385 CGGGAGGAGGGAGCGGCAAGGGG - Intergenic
1083659812 11:64246793-64246815 GCGGCGGCGGGGGCGCCCGGGGG + Exonic
1083747689 11:64744788-64744810 CGGCGGGCGGGAGCGCACGGAGG - Intronic
1083895774 11:65619027-65619049 CTGGCGGGGGGAGCTGCAGGAGG + Exonic
1084028449 11:66467048-66467070 GGGGCGGGGGCTGCGCCAGGCGG + Intronic
1084063911 11:66692652-66692674 AGAGCGGCGGGAGCGCCTGCAGG - Exonic
1084336568 11:68461056-68461078 CGGGCGCCGGGAGCGGGACGCGG + Intronic
1084941632 11:72616300-72616322 GGGGCAGTGGGAGCCCCAGGTGG - Intronic
1085463393 11:76708574-76708596 GGGGCTGCTGGAGAGCCAGGGGG + Intergenic
1087946243 11:104163999-104164021 CAGGCGGCGAGAGCGCAGGGCGG - Exonic
1089442872 11:118531146-118531168 GGGGCGGGGGCTGCGCCAGGCGG - Exonic
1089943225 11:122440956-122440978 CGGGCTGAGGAAGAGCCAGGAGG - Intergenic
1090056702 11:123430487-123430509 CGCGCGAGGGGAGCCCCAGGAGG + Exonic
1091000982 11:131910736-131910758 CGGGCGGCGGGAGCGGACCGCGG - Intronic
1202813313 11_KI270721v1_random:36568-36590 GCGGCTGCGGGAGCCCCAGGGGG - Intergenic
1091383553 12:78039-78061 GGGGCGGCGGGGGCGCGCGGAGG - Intronic
1093381538 12:18500188-18500210 CGGCCGGCTGGAGTTCCAGGTGG + Intronic
1094565025 12:31591165-31591187 CGGGCTGTGGGAGCGCGGGGCGG + Intergenic
1096157340 12:49347889-49347911 CGGGCGGGAGGAGTCCCAGGCGG + Exonic
1096469849 12:51869219-51869241 CGAGGGGCGGGAGCTCCAGGTGG - Intergenic
1096595384 12:52691874-52691896 TGGGTGGAGGGAGGGCCAGGAGG - Intronic
1096784413 12:54009053-54009075 CGGGCGGCGGCGGCGGCGGGCGG - Intronic
1097288494 12:57895505-57895527 CGGGTGGGAGGAGGGCCAGGAGG + Intergenic
1098288468 12:68933074-68933096 CGGACGGCGGAGGCGCCAGGAGG - Intronic
1098740739 12:74170978-74171000 CGGGGGGCGGGAGGCGCAGGCGG - Intergenic
1098943125 12:76559814-76559836 CGGGGGGCGGGCGGGGCAGGGGG - Intergenic
1100911158 12:99365171-99365193 TGGGCGGCAGGAGCTGCAGGAGG - Intronic
1101813609 12:108129206-108129228 GAGGCTGCGGGAGGGCCAGGTGG + Intergenic
1102471940 12:113164156-113164178 GGGGCGGCAGGAGCAGCAGGAGG - Exonic
1103779450 12:123389241-123389263 CGGGCGGCGGGAGGGCGACGCGG + Intronic
1104448853 12:128853565-128853587 CGGGCGGCGGCGGCGGCATGCGG + Exonic
1104847082 12:131852048-131852070 CGGGCGGGCGGGGCGCCAGCTGG + Intergenic
1104916726 12:132269368-132269390 CGAGGAGCGGGACCGCCAGGCGG + Intronic
1104977763 12:132559938-132559960 CGGGAGGCGGGAGCGCGGGCGGG - Intronic
1106208718 13:27621699-27621721 CTCGCGGCGGGAGGGGCAGGGGG - Exonic
1106322943 13:28659201-28659223 CGGGCGGCTGGAGTTCCACGCGG + Intronic
1108408022 13:50124341-50124363 CGGGCGGCGGGAGAAGCAGTCGG + Intronic
1108689917 13:52850850-52850872 CCGGCAGCAGCAGCGCCAGGCGG - Intergenic
1112344372 13:98577327-98577349 CGGGCGGCGGGGCCGGGAGGGGG + Intronic
1113417345 13:110138512-110138534 CGGGCGGCGCGCGCGCCCAGGGG + Intergenic
1113737600 13:112689799-112689821 CGGGAGGCGGAAGCAACAGGGGG + Intergenic
1114635158 14:24183095-24183117 CAGGGAGCGGGAACGCCAGGTGG - Exonic
1116426614 14:44798950-44798972 GGGGCGGCGGGAGGGCGGGGAGG - Intergenic
1117251856 14:53946860-53946882 GCGGCGGCGGGGGCACCAGGGGG - Intergenic
1118607663 14:67515296-67515318 CGCGGCGCGGGAGTGCCAGGCGG - Exonic
1119438206 14:74611654-74611676 CGGGCTGGGGGAGCCCCAGGAGG - Exonic
1120787980 14:88554612-88554634 CGGCCGGCGGGAGGGGCGGGCGG - Intronic
1120953447 14:90062052-90062074 CGGCCTGCGGGAGAGCCCGGCGG + Exonic
1121093969 14:91202872-91202894 GGGGCGGCGGGGGCCACAGGAGG - Intronic
1121101441 14:91253136-91253158 TGGGCTGGGGCAGCGCCAGGTGG - Intronic
1121473517 14:94174440-94174462 CGGGCGGCGAGAGTGCCCGGCGG + Exonic
1122447661 14:101781470-101781492 GGGGCGGCAGGAGGGCCCGGCGG - Intronic
1123061954 14:105598481-105598503 CGGGCCGGGGTAGGGCCAGGAGG - Intergenic
1123086698 14:105720212-105720234 CGGGCCGGGGTAGGGCCAGGAGG - Intergenic
1123710067 15:22980435-22980457 CGGGAGGGAGGAGCGCCGGGAGG - Intronic
1124496849 15:30192361-30192383 AGGGGGGCGTGGGCGCCAGGAGG - Intergenic
1124746727 15:32346286-32346308 AGGGGGGCGTGGGCGCCAGGAGG + Intergenic
1125685014 15:41558946-41558968 CGGGCTGCGGGCGGGCCGGGAGG + Intronic
1127342904 15:58065889-58065911 CGGGGGGCGGGAGCGCCGGGCGG - Exonic
1128374792 15:67066741-67066763 CGGGCCGCGGGGGCGGGAGGCGG - Intronic
1128454583 15:67825444-67825466 CGGGCGGGGGCAGTGCAAGGAGG - Intronic
1128894194 15:71357589-71357611 CTGCAGGCGGGAGAGCCAGGAGG - Intronic
1129871617 15:78945080-78945102 GGAGCGGCGGGAGCGCGAAGGGG + Exonic
1129878242 15:78990946-78990968 AGGGCTGCGAGAGTGCCAGGTGG + Intronic
1130002551 15:80059904-80059926 CGGGCGCCGGGAGGGGCCGGGGG - Intronic
1131144263 15:90001481-90001503 CAGGCGGCGGGCGCGCGTGGAGG + Exonic
1132398121 15:101489213-101489235 CGGGCGGCCGGGGCGCCCTGCGG - Intronic
1132499790 16:280309-280331 GGCGCGGCGGGAGCCCGAGGGGG - Intronic
1132516853 16:370029-370051 CGGGCAGCGGGAGCGTGTGGAGG - Exonic
1132683371 16:1152825-1152847 CGGGCGTGGGGTGCACCAGGGGG - Intergenic
1132739253 16:1403181-1403203 CGGGCGGCCGCAGGTCCAGGGGG + Exonic
1132891211 16:2205727-2205749 CGGGCTGCGCGTGCGCAAGGCGG - Intronic
1133183314 16:4075739-4075761 GGGGCAGCGGGGGGGCCAGGCGG + Intronic
1134102675 16:11462950-11462972 TGGGAGCCGGGAGAGCCAGGAGG - Intronic
1134644976 16:15858370-15858392 GGAGCGGCGGGAGCGGCGGGCGG + Intergenic
1135040497 16:19114092-19114114 GGAGCGGCGGGAGAGCCAGGAGG + Exonic
1136761945 16:32741180-32741202 CGGGAAGCGGGAGAGTCAGGAGG + Intergenic
1136806155 16:33129208-33129230 CGGGAAGCGGGAGAGTCAGGAGG - Intergenic
1136913937 16:34163699-34163721 CGGGGGGCGGGCGGGCTAGGAGG - Intergenic
1138514517 16:57528742-57528764 CGCACGGCGCGAGCGCCAAGAGG - Exonic
1139511672 16:67431458-67431480 GGCGCTGCGGGCGCGCCAGGCGG - Exonic
1139676942 16:68530280-68530302 CTGGCGGCGGGGGTGCCGGGAGG - Intronic
1139951498 16:70674429-70674451 CAGGCTGCGGTAGCGACAGGTGG + Exonic
1141665963 16:85465235-85465257 GGGGAGGCAGGAGCTCCAGGTGG - Intergenic
1141764246 16:86048272-86048294 GGGGAGGAGGGAGCGCCAGCAGG - Intergenic
1142060602 16:88026953-88026975 AGGAGGGCGGGAGGGCCAGGTGG + Intronic
1142120245 16:88383403-88383425 CGGGCGCCGCGAGCGCTGGGAGG - Intergenic
1142136346 16:88453560-88453582 CGGGCGGCGGGGGCGCGGCGGGG - Exonic
1142518735 17:490287-490309 CGGGCGGGGGGGGCGCCTGGAGG - Intergenic
1143401921 17:6651726-6651748 CGGGCCGTGGGAGCGCCTGAGGG + Exonic
1143402416 17:6655108-6655130 CGGGCTGTGGGAGCGCCTGAGGG + Intergenic
1143680840 17:8475009-8475031 AGGGCGCCGGCAGAGCCAGGCGG + Exonic
1143750044 17:9021463-9021485 CGGGGGGCGGGGCCGCCGGGCGG - Intergenic
1144565142 17:16353488-16353510 CGGGCGGCGGGGGCGCGCGCAGG - Exonic
1145990889 17:29078818-29078840 GGGGAGGCAGGAGAGCCAGGGGG + Exonic
1146062251 17:29613513-29613535 GCGGCGGCGCGCGCGCCAGGAGG + Exonic
1146753725 17:35407667-35407689 CGGGCTGTGGGAGCTGCAGGTGG - Intergenic
1147402802 17:40191274-40191296 GGGGCGGCCAGGGCGCCAGGGGG - Intronic
1147705548 17:42422701-42422723 CGGCAGCCTGGAGCGCCAGGCGG - Exonic
1147987584 17:44315341-44315363 CGGGGGGCGGGCGGGCCGGGCGG + Intronic
1148060102 17:44830250-44830272 GCGGCGGCGGGAGCGGGAGGCGG - Intronic
1148337712 17:46852267-46852289 CGGACGGTGAGAGCGCCAGCTGG + Intronic
1148558379 17:48592123-48592145 CGGGCGGCGGCAGAGCGGGGAGG + Exonic
1150239854 17:63622664-63622686 CGGGCGGCGGGGACGGCAGCGGG - Exonic
1150373513 17:64661894-64661916 GGGGCGGCGGGGGCGGCGGGCGG + Exonic
1150423342 17:65057147-65057169 CGGGCAGCGGGCGCGCAACGCGG - Intergenic
1151812448 17:76452685-76452707 TGGGCGGCGCGGGCGGCAGGGGG - Intronic
1152042038 17:77909845-77909867 CAGGCTGCGGGTGCGGCAGGTGG - Intergenic
1152302968 17:79506228-79506250 AGGGAGGAGGGAGTGCCAGGAGG + Intronic
1152553957 17:81043813-81043835 CGCGCGGCTGGAGAGCCAGAGGG - Intronic
1153688209 18:7567249-7567271 CGGGCCGCGGCGGCGCCGGGCGG + Exonic
1153855186 18:9137505-9137527 CTGGCGGCGGGAACGCGCGGCGG - Intronic
1154253769 18:12765810-12765832 GGGGCGGCTCGAGCTCCAGGCGG - Intergenic
1155507789 18:26549033-26549055 GGGGCGGCGGCTGCGCCGGGCGG + Exonic
1156008581 18:32470976-32470998 CGGGCCGCGGGAGCTGCGGGAGG - Intergenic
1156411056 18:36828787-36828809 CGCGCGGCGGGAGCGGGTGGAGG + Exonic
1158435942 18:57435667-57435689 GGGGCGGCGGGGGCGGCCGGCGG - Exonic
1159040546 18:63319952-63319974 TGCGCGGCGGGAGCTCCGGGAGG - Exonic
1160204729 18:76822967-76822989 CGGGCCGCGGCAGGGCCAGCGGG - Intronic
1160788628 19:912831-912853 CGAGCCCCCGGAGCGCCAGGAGG + Intronic
1160847671 19:1173629-1173651 GGGGCGGCGGGAGAGACCGGGGG + Intronic
1160862055 19:1241607-1241629 CGGGCTGCGGCAGAACCAGGGGG - Intergenic
1160967883 19:1754486-1754508 CGGGCAGCGGGAGCGCCGCGGGG + Exonic
1161025632 19:2035433-2035455 CTGGAGGCGGGAGCGGAAGGAGG - Intergenic
1161262513 19:3345638-3345660 CGGGCGGCGGGAGGGGGGGGCGG - Intergenic
1161302905 19:3551541-3551563 CGGGGAGCGGGAGGCCCAGGTGG + Intronic
1161364155 19:3868702-3868724 CTGTCGGCGGGAGCGGGAGGGGG - Intronic
1161752920 19:6110529-6110551 CTGGCGGCGGGAGCCGGAGGAGG - Exonic
1162396639 19:10421063-10421085 CGGGCGGAGGCAGCAGCAGGCGG + Exonic
1162750347 19:12825769-12825791 AGGGCTGCGGGAACGCCGGGAGG + Exonic
1162778601 19:12995413-12995435 CGGGCGGCGCGGGCGGGAGGAGG - Intergenic
1162818190 19:13208524-13208546 GGGGCGGCGGGTGGGCAAGGGGG + Intronic
1163154426 19:15432364-15432386 GGGGCGGCGGCACCGGCAGGCGG + Intronic
1163234350 19:16022313-16022335 GGGGCGGCTGGAGCCCCTGGTGG + Intergenic
1163427087 19:17245730-17245752 CGGGCGCCGGGGGACCCAGGGGG - Exonic
1163828090 19:19535027-19535049 CGGGCAACGGGAACGCCTGGTGG - Exonic
1165349548 19:35268634-35268656 CGGGCGGCGGCCGCGCGAGCCGG + Intergenic
1165833005 19:38738414-38738436 CGGGGGCCTGGAGCGACAGGTGG - Exonic
1166326054 19:42051836-42051858 CAGGCAGCAGGAGCGGCAGGAGG - Intronic
1166873951 19:45886070-45886092 AGAGCGGCGGGAGCCCGAGGCGG - Exonic
1167379531 19:49130470-49130492 CCAGCTGCGGGAGCGCCTGGCGG + Exonic
1167428406 19:49441415-49441437 CGGGCGGGGGGATCGGCGGGGGG - Exonic
1167570104 19:50281599-50281621 CGAGTGGCGGCGGCGCCAGGAGG + Exonic
1167649474 19:50721526-50721548 CGGCTGCCGGGAGCCCCAGGAGG - Intergenic
1168293786 19:55369404-55369426 CGGGCCGCGGGAGCCCGAGCTGG + Intronic
1168325596 19:55537066-55537088 CCGGCGGCCGGAGGGTCAGGAGG - Exonic
1168722655 19:58562761-58562783 CGTGCTGCTGGAGCACCAGGCGG - Exonic
925959772 2:9003798-9003820 GGGGCGGCGGGCGCGGGAGGAGG - Exonic
926703212 2:15818078-15818100 TGGGAGACGGGAGCCCCAGGAGG + Intergenic
927591294 2:24360300-24360322 GGCGCGGCGAGGGCGCCAGGTGG - Exonic
927686466 2:25174678-25174700 CTGGCTGCGGGCGTGCCAGGTGG + Intergenic
928127249 2:28625312-28625334 CCGGCTGCGGGAGGGCAAGGTGG + Intronic
929188705 2:39120732-39120754 CGGGCGGCGGCCGCGGCAGAGGG - Intronic
931232124 2:60383728-60383750 CAGGCGGCGGCAGGGTCAGGGGG + Intergenic
932699843 2:73985044-73985066 CGGGAGGCGGGAGCCCCAGGCGG + Intergenic
938408248 2:131044581-131044603 AGGCAGGCGGGAGCGCCGGGTGG - Intronic
938451479 2:131425109-131425131 CGGGAGGCGGGCGCGGGAGGCGG + Intergenic
938451484 2:131425122-131425144 CGGGAGGCGGGCGCGGGAGGCGG + Intergenic
938451489 2:131425135-131425157 CGGGAGGCGGGCGCGGGAGGCGG + Intergenic
938451494 2:131425148-131425170 CGGGAGGCGGGCGCGGGAGGCGG + Intergenic
938451499 2:131425161-131425183 CGGGAGGCGGGCGCGGGAGGCGG + Intergenic
938451504 2:131425174-131425196 CGGGAGGCGGGCGCGGGAGGCGG + Intergenic
938451509 2:131425187-131425209 CGGGAGGCGGGCGCGGGAGGCGG + Intergenic
938451514 2:131425200-131425222 CGGGAGGCGGGCGCGGGAGGCGG + Intergenic
938451519 2:131425213-131425235 CGGGAGGCGGGCGCGGGAGGCGG + Intergenic
941295663 2:163736198-163736220 CGGGCAGCGGGAGGACCAGGAGG + Intergenic
942083935 2:172427491-172427513 CGGGCCGCGGGCGCGCAAGGAGG + Intronic
942241124 2:173964717-173964739 CGGGCGGGGGCAGCAGCAGGAGG - Intronic
942681338 2:178480564-178480586 CGGGCTGCGGAAGCGCGAGCAGG + Exonic
947218162 2:227768061-227768083 CTGGCGGCGCCAGCTCCAGGAGG + Intergenic
947636027 2:231681119-231681141 GGGGCGGGGCGAGCGCCTGGGGG + Intergenic
947650294 2:231780973-231780995 GGGGCGGGGGCCGCGCCAGGTGG - Intronic
947824020 2:233092160-233092182 CGGGCGGCCGGAGTGACTGGGGG + Intronic
948164579 2:235851254-235851276 CGAGCAGCAGGAGCGCCAGGTGG - Intronic
948850881 2:240704711-240704733 CGTCCGGCGGGAGCGCCACATGG - Intergenic
949004602 2:241637892-241637914 TGGGCGGTGGGAGCGGGAGGGGG + Intronic
949080059 2:242089133-242089155 TGGGCCGCGGGCGCGTCAGGTGG + Intergenic
1169118741 20:3083188-3083210 CGGGCGGGGTGAGCGGGAGGAGG + Intronic
1169558116 20:6770049-6770071 CGGGCCGCGGGGGCGCGAGGGGG + Intronic
1171010798 20:21508550-21508572 TGGGCCGAGGGAGCGCGAGGAGG - Intergenic
1171567330 20:26208081-26208103 CGGGCGGCGGGCGGGGAAGGGGG + Intergenic
1172252525 20:33490009-33490031 CTGGCGGCGAGAGCGCGCGGCGG + Intergenic
1173807463 20:45935085-45935107 CCGGGGGCGGGAGCGCGCGGCGG + Intronic
1173847171 20:46195565-46195587 TGGGAGGCGGGAGTGCCAAGGGG - Intronic
1174386538 20:50191069-50191091 CAGGCGGCGGCGGCGGCAGGGGG - Exonic
1175887939 20:62302929-62302951 TCGGCGGCGAGAGCGGCAGGCGG + Exonic
1175994222 20:62805130-62805152 GGGGCTGCGGGAGCTCCAGGAGG - Intronic
1176077319 20:63254351-63254373 CGGGCACCGGGGGCTCCAGGAGG + Intronic
1176081786 20:63277095-63277117 CGGGTGGTGGGTGCTCCAGGCGG + Intronic
1176234796 20:64049279-64049301 CGGCCGCGGGGAACGCCAGGCGG - Exonic
1176237971 20:64063101-64063123 GGCGCGGCGGGCGCGGCAGGCGG + Intronic
1176381050 21:6112022-6112044 CGGGCGGCGGGGGCGCTGGTGGG + Intronic
1178073327 21:28992951-28992973 CGGGAGGCGGGAGCGGAAGTGGG - Exonic
1178327905 21:31660081-31660103 CGCGTGGCGGGAGCGCGGGGAGG + Intronic
1179142076 21:38734433-38734455 TCGGCGGCGGGAATGCCAGGCGG + Intergenic
1179742422 21:43426218-43426240 CGGGCGGCGGGGGCGCTGGTGGG - Intronic
1179882670 21:44300062-44300084 CAGGCGGCGGGAGTGCGAGCTGG + Exonic
1179958054 21:44752059-44752081 GTGGGGGCGGGGGCGCCAGGGGG - Intergenic
1179999875 21:44990784-44990806 CGAGCTGCAGGAGGGCCAGGAGG - Intergenic
1180034071 21:45234274-45234296 CGGCAGGCGGAAGCGGCAGGCGG + Intergenic
1180034074 21:45234287-45234309 CGGCAGGCGGAAGCGGCAGGCGG + Intergenic
1180095927 21:45555299-45555321 GGGGCGGCGGGGGCGGCGGGGGG + Intergenic
1180231727 21:46430432-46430454 CGGGGGCTGGGAGCTCCAGGAGG - Intronic
1180961934 22:19766178-19766200 CGGGCGGCGGCGGCGGCGGGCGG - Intronic
1182576469 22:31276563-31276585 GCGGCGGCGGGGGCGCCCGGGGG - Intronic
1183229187 22:36570256-36570278 AGGGCGGCGGGAGAGCAGGGAGG + Intronic
1183427082 22:37745964-37745986 CGGGCCGCGGGCGCGCTGGGAGG - Intronic
1184033951 22:41909960-41909982 CGGGCGACTGGAGGTCCAGGCGG + Exonic
1184101501 22:42343729-42343751 CGGGCGGCGCGGGCTCCCGGCGG + Intergenic
1184164761 22:42720750-42720772 CGGGGGACGGGGGCTCCAGGGGG - Intronic
1184680743 22:46071198-46071220 CGGGCGGCGGGAGGGGCCGCGGG + Intronic
1185037869 22:48489275-48489297 CGGGCGGCTGGAGCCCCCAGCGG + Intergenic
1185255215 22:49827792-49827814 CGGGCGGCGGGCGCGGGACGCGG + Intergenic
1185278859 22:49961382-49961404 CGGGCGGCGGCGGCGGCGGGGGG + Intronic
1185409581 22:50674768-50674790 CGGGCGCCGGGCGCGCCCGGCGG - Intergenic
950084585 3:10248533-10248555 CGGGCGGAGGCCGGGCCAGGCGG + Exonic
951485258 3:23203129-23203151 CGGGCGGCGGCGGCTCCCGGAGG + Intronic
954702017 3:52455533-52455555 CGCGCGGCGGGGGCGACGGGCGG + Exonic
954715260 3:52523735-52523757 CGGGCTGTGGGGGTGCCAGGAGG - Exonic
954810318 3:53243417-53243439 CTGGCGGCGTGAGCTCCAGATGG - Intronic
955818606 3:62874131-62874153 CGGGCGGGGGCAACGGCAGGTGG - Intronic
958718872 3:97821544-97821566 CGGGCGGCGGGAGGGAGAAGGGG - Intergenic
961034677 3:123634309-123634331 AGGGCAGCGGCAGCCCCAGGTGG + Intronic
961236866 3:125375018-125375040 CGCGCGGGGGGAGCGCGCGGCGG - Intronic
963733265 3:148992102-148992124 CGGGCGGCGGAGGAGCCGGGCGG - Intronic
963743031 3:149098168-149098190 CGGCCGGCGGGAGTTCCGGGTGG - Intergenic
966787572 3:183635473-183635495 CCCACGGCGGGAGCCCCAGGTGG + Intergenic
968006524 3:195246893-195246915 CAGGAGGCTGGAGCGGCAGGTGG - Intronic
968293499 3:197556060-197556082 TGGGCGGGAGGAGCGCCAGCCGG - Intronic
968503837 4:963041-963063 CGGCCGGCAGGAGCTCCACGGGG - Intronic
968613763 4:1568391-1568413 GTGGCGGCGTGAGCTCCAGGAGG - Intergenic
968651941 4:1763604-1763626 CGGGCGGGCGGGGCGCCGGGAGG + Intergenic
968673008 4:1862509-1862531 GGGGCTGCGGGGGCGGCAGGAGG + Intergenic
968674827 4:1871652-1871674 GAGGGGGCGGGAGCGCCGGGAGG + Intronic
968809359 4:2793060-2793082 CCGCGGGCGGGAGCGCCTGGCGG + Intronic
968835720 4:2963252-2963274 GCGCCGGCGGGAGCGCGAGGGGG - Exonic
969053415 4:4387582-4387604 CCTGCGGCGGGAGGGCCGGGGGG - Exonic
969597827 4:8158880-8158902 CGCGGGGCGGGGCCGCCAGGAGG - Intergenic
969697024 4:8740777-8740799 CGGGCGGCTGGGGCTGCAGGAGG - Intergenic
970194632 4:13542431-13542453 CCGGCGGCGGGGGCGGCAGCGGG - Exonic
971327433 4:25655739-25655761 CCGGCGGCGGCTGCGGCAGGCGG + Intronic
973954463 4:56049268-56049290 CTGCCAGCCGGAGCGCCAGGCGG + Intergenic
977574060 4:98658656-98658678 CGGGCGGGCGGAGCGAGAGGCGG - Intergenic
978885432 4:113761803-113761825 CAGGCGGAGGGAGCGGCGGGAGG - Intronic
980075410 4:128288278-128288300 CGGGCGGGGGGAGCGCAAGGAGG - Exonic
981937921 4:150254383-150254405 CAGGCGGCGGGAGAGGCAGAAGG - Intronic
982033640 4:151325319-151325341 CCGGCGGCGGGAGGACGAGGAGG - Intronic
984167608 4:176320628-176320650 AGCGCGGCGGCAGCGCCTGGAGG - Intronic
985111965 4:186555437-186555459 TGGGCGCGGGGAGCGCCGGGCGG - Exonic
985629897 5:1008892-1008914 CGGGGGCCGGGGGAGCCAGGGGG - Exonic
987050567 5:14144115-14144137 CGGGCGCAGGGAGGGCGAGGTGG - Intronic
988564808 5:32312623-32312645 CGGGCGACGGGGCAGCCAGGCGG - Intronic
990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG + Exonic
992530120 5:77645266-77645288 CGGGCGGCGGGCGCGGCCGAGGG - Intergenic
994631812 5:102296370-102296392 CTGGAGGCTGGAGGGCCAGGAGG - Exonic
998349659 5:141492401-141492423 CCGGCGGAGGGAGCGGCAGAGGG - Intronic
999799563 5:155020066-155020088 TGGGCGGCTGTAGCTCCAGGAGG + Intergenic
1000209332 5:159096267-159096289 GGGGCGCAGGGAGCTCCAGGTGG - Intronic
1002064237 5:176644126-176644148 CTGGAGGGGGGAGCACCAGGGGG + Intronic
1002102112 5:176862787-176862809 CGGGGAGTGGGTGCGCCAGGTGG + Exonic
1002498903 5:179634539-179634561 CGGCCGGCCGGAGCGCGGGGCGG + Intronic
1002502773 5:179657985-179658007 CGGCCGGCCGGAGCGCGGGGCGG - Intergenic
1002785006 6:393482-393504 CGGGCGGCGGAGGCATCAGGTGG + Intronic
1003062857 6:2876150-2876172 TGGGCGGCGGGCGCCGCAGGGGG + Intergenic
1004203883 6:13574281-13574303 CGGGAGGCGGGCGCGCCGGCTGG - Intergenic
1004426988 6:15513429-15513451 AGGGCGCCGGCAGGGCCAGGCGG - Intronic
1005806070 6:29475537-29475559 TGGGCGGTGGCAGCACCAGGTGG + Intergenic
1005814269 6:29538253-29538275 TGGGCGGTGGCAGCACCAGGTGG + Intergenic
1006180728 6:32151973-32151995 CGGGCGGAGGGAGAGCGGGGAGG + Intronic
1006815220 6:36845462-36845484 CTGGCGGCAGGAGGGCCATGGGG - Intergenic
1008945277 6:57090148-57090170 CGGGTCCCGGTAGCGCCAGGCGG + Exonic
1014632508 6:123803794-123803816 CGGGCGGCGGCCGCGCTGGGGGG + Intergenic
1015816721 6:137219090-137219112 CGGGCGACGGGGACGCGAGGTGG - Intronic
1016328236 6:142927047-142927069 GAGGCGCCGGGAGCGCCAGCGGG - Intronic
1019298067 7:289638-289660 CGGGCGCCGGGATCCCCGGGAGG - Intergenic
1019383697 7:741477-741499 CGGCAGAGGGGAGCGCCAGGAGG + Intronic
1019395716 7:816719-816741 CGGGCTGCGGGGACGCGAGGCGG + Intronic
1019472652 7:1229692-1229714 CGGGCGGGGGAAGGGGCAGGCGG + Intergenic
1019712546 7:2524242-2524264 GGGGTGGCGGGAGGGACAGGCGG - Intronic
1020035120 7:4959560-4959582 GGGAAGGCGGGGGCGCCAGGTGG + Intergenic
1020283621 7:6664034-6664056 GGGGCGGCGGGTGAGCCTGGGGG + Intergenic
1021798936 7:24284959-24284981 CGCGCGGCGAGAGTGCAAGGTGG - Exonic
1023972313 7:45000307-45000329 CGGGCCGCGGGAGCCGCACGCGG + Intronic
1024580020 7:50793568-50793590 CGGGCGGCGGCGGCGGGAGGAGG - Intergenic
1024639346 7:51316818-51316840 GGGGCGCCGGGAGCGCAGGGAGG + Intronic
1025004644 7:55344481-55344503 CCGGCGGAAGGAGCGCCTGGAGG + Intergenic
1025069779 7:55887838-55887860 CGGGCGGCGGCGGCGGCGGGCGG + Intronic
1025069797 7:55887886-55887908 CGGGCGGCGGCGGCGGCGGGAGG + Intronic
1026471111 7:70694618-70694640 CGGCCGGCGGGAGGGCGAGGCGG - Intronic
1026801832 7:73405032-73405054 GGGGCTGTGGGAGCCCCAGGTGG + Intergenic
1026837382 7:73647826-73647848 CGGGCGGCGGGGGCGCTGCGGGG + Intergenic
1026899606 7:74029531-74029553 TGGGGGGCGGGAGGGCCACGGGG + Intronic
1027390348 7:77697106-77697128 CGGGCCCCGTGGGCGCCAGGGGG - Intronic
1029414825 7:100436173-100436195 CGGGCGGCGGAAGGGGCGGGCGG - Exonic
1029444540 7:100604854-100604876 CGGGCGGTGGAAGCGGGAGGAGG - Intronic
1029449590 7:100633380-100633402 CGGGCGGGGGGCGCGCGGGGAGG - Intronic
1029537000 7:101162955-101162977 CGCGCGGCGGGGGCGCGCGGGGG + Exonic
1032516351 7:132508954-132508976 CGGGTGGCAGCAGCCCCAGGAGG + Intronic
1032781972 7:135170794-135170816 CGGGCGCCGGGACTGCGAGGGGG - Intronic
1034414719 7:150958399-150958421 CGGGCGGCGCGGGCGCCCCGGGG - Exonic
1034560438 7:151876450-151876472 CCGGGGACGGGAGCGACAGGAGG + Intronic
1035024499 7:155817127-155817149 CGGGCTGGGGGAGCAGCAGGGGG - Intergenic
1035153220 7:156892655-156892677 CGAACGGAGGGAGCGCGAGGGGG + Intronic
1035167843 7:157002381-157002403 CTGGCAGCCGGAGCTCCAGGAGG + Intronic
1035335391 7:158124717-158124739 GGGGCGGAGGGAGGGCCTGGTGG + Intronic
1035538099 8:407396-407418 TGGGCCGCGGGCGCGTCAGGTGG + Intronic
1035595150 8:851840-851862 TGGGTGGCGGGAGCTGCAGGGGG + Intergenic
1037825298 8:22156813-22156835 CGGGCGGCGGGGGCGCGCGCGGG + Exonic
1038176318 8:25184634-25184656 CGGGCGGAGGGTGCGGCCGGCGG + Intergenic
1039476433 8:37841591-37841613 GGGGCCGCGGGAGAGGCAGGGGG - Exonic
1039864588 8:41490297-41490319 CGGCCGGCGCGAGCGCGCGGGGG - Intergenic
1040807434 8:51409283-51409305 GGGGCGGCGGGAGGGGCTGGCGG + Exonic
1040835187 8:51723692-51723714 TGGGCTGCGGGAGCACCAGCAGG + Intronic
1041690153 8:60679656-60679678 CGGGGGGCGGGGGCGGGAGGCGG - Intronic
1042021985 8:64378261-64378283 CGGGCGGAGGGAGGGCAAGCAGG - Intergenic
1048029569 8:130618435-130618457 CGGGGGGCGGGGGGGCCAAGGGG + Intergenic
1048214137 8:132480492-132480514 AGGGCGGCGGGGGCGGCTGGCGG - Exonic
1048925136 8:139264860-139264882 AGGGAGGCGGGAGGGGCAGGAGG - Intergenic
1049235544 8:141510591-141510613 CTGGCGGGGGGAGCGCTGGGAGG + Intergenic
1049419488 8:142510592-142510614 GGGGCGGCGGGGGCGCGGGGCGG + Intronic
1050873968 9:10612889-10612911 CCGGCGGCCGGAGCGCGTGGGGG - Intergenic
1053885931 9:42645245-42645267 ATGGCGGCCGGAGCGCTAGGCGG + Intergenic
1054224949 9:62452694-62452716 ATGGCGGCCGGAGCGCTAGGCGG + Intergenic
1054798540 9:69325087-69325109 CGGGAGGCGGACCCGCCAGGCGG + Intronic
1055757605 9:79572616-79572638 CGGGCGGCAGGAACGCGCGGCGG - Exonic
1057619135 9:96619505-96619527 CGGGCGCCGGCAGAGCCCGGCGG + Exonic
1059358517 9:113720060-113720082 ATGGAGGCGGGAGTGCCAGGAGG - Intergenic
1060254555 9:122015659-122015681 CGTCCGGTGGGAGCGCCAGGTGG - Intronic
1060468680 9:123929982-123930004 GGGGCGGGGAGAGCGCCAGAGGG - Exonic
1060484691 9:124039675-124039697 TGGGGGGAGGGAGAGCCAGGAGG + Intergenic
1061075785 9:128340665-128340687 CGGGCGGCGGGCGGGGCTGGCGG + Intronic
1061625430 9:131838409-131838431 CGGGGGGGGGGGGCGTCAGGCGG + Intergenic
1061890143 9:133614978-133615000 GGGGCGGTGGGAGCCACAGGAGG + Intergenic
1062230740 9:135480134-135480156 CGGGCGGCGGGGGCTCCCCGAGG + Intronic
1062491855 9:136808563-136808585 AGCGCGGCGGGAGCGACACGCGG - Intronic
1062596245 9:137301188-137301210 CGGGCGGCGGGAGCCGAAGGCGG - Exonic
1062634730 9:137484848-137484870 GGGGAGGCGGGAGGGCCAGGCGG - Intronic
1062659194 9:137619357-137619379 CGGGCGGCGGCGGCGGCACGGGG - Intronic
1203360425 Un_KI270442v1:216641-216663 CGGGGGGCGGGCGGGCGAGGAGG + Intergenic
1186393705 X:9186452-9186474 CAGGCGGTGGGAGCCCCATGAGG - Intergenic
1189323125 X:40098012-40098034 CGGGCGGAGGGAGGGGGAGGAGG - Intronic
1189324988 X:40106533-40106555 CGGGAGGCGGGAGCGCGGGCGGG - Intronic
1189324998 X:40106557-40106579 CGGGAGGCGGGAGCGCGGGGAGG - Intronic
1192251418 X:69417006-69417028 TGGGGGGCGGGGGCGGCAGGGGG - Intergenic
1192425062 X:71068082-71068104 CGGGCGGCGCGAGCGGGAGGGGG - Intronic
1192473734 X:71420953-71420975 CGGGCGGCTGGGGCTGCAGGCGG - Intronic
1192561540 X:72131138-72131160 CGGGCGGAGGCAGCGCCGGCGGG + Exonic
1192630951 X:72777477-72777499 GGGGCGGCGGGGGCGCGGGGCGG - Intronic
1192650758 X:72943324-72943346 GGGGCGGCGGGGGCGCGGGGCGG + Intronic
1196297441 X:114015170-114015192 CGGGCGGAGGGGGGGACAGGGGG + Intergenic
1199760225 X:150899028-150899050 CGGGAGGCGGCAGCGCCGGTGGG + Intergenic
1200100901 X:153688709-153688731 CGCGCGGCGGCACGGCCAGGCGG - Exonic
1200203049 X:154295702-154295724 CCGGCGGAGGGAGCGGCAGGTGG + Exonic