ID: 1072022004

View in Genome Browser
Species Human (GRCh38)
Location 10:91411010-91411032
Sequence CTGTTTAATCTGAAGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072022004 Original CRISPR CTGTTTAATCTGAAGGGGGA AGG (reversed) Intronic
904004591 1:27357106-27357128 CTGCTTCACCTGCAGGGGGAGGG + Exonic
904377139 1:30088843-30088865 ATGTTTGATCTGATGGGGGGAGG - Intergenic
906814872 1:48868326-48868348 CTGCTTAAGCAGAAAGGGGAAGG + Intronic
909728749 1:78868546-78868568 CTAATTAATCTGAAGGAGGCAGG + Intergenic
911330952 1:96525225-96525247 ATGTTTAAGCTGAAAGGTGAAGG + Intergenic
912482653 1:109995761-109995783 CTGTGTAATCAGAATGGGGGAGG + Intronic
913452754 1:119003259-119003281 CTGCTTAATCAGGAGGGTGATGG - Intergenic
913713471 1:121510756-121510778 CCCTTTAAGCTGTAGGGGGAGGG + Intergenic
916502212 1:165396692-165396714 CTGTATACCCTGAAGGGGTAGGG + Intergenic
916719780 1:167475651-167475673 CTGTTGAATCTGGAGGTTGATGG - Intronic
916903904 1:169260667-169260689 ATGTTTAATCTGCAGAGGAAAGG + Intronic
918746250 1:188203894-188203916 GTGTTCAATCTGTAAGGGGAGGG - Intergenic
919444161 1:197680261-197680283 ATATTTAGTCTGAAGGGGGTAGG - Intronic
920784758 1:209030498-209030520 TTGTTTAATCTGAAGAGAAAAGG + Intergenic
921490518 1:215770283-215770305 CTGCTTAATCTTCAGAGGGAAGG - Intronic
922621030 1:226988326-226988348 CTGTTTACTCTGCAGGGCGATGG - Intergenic
924043931 1:240009483-240009505 ATGTTTACTCTGAAGTGGGGAGG + Intergenic
924686573 1:246298014-246298036 ATGCTTAAAATGAAGGGGGATGG + Intronic
1064896252 10:20240573-20240595 CTGTTAAATCTGAAGCTGCAGGG - Intronic
1065405112 10:25355768-25355790 CTGTTTATTCTGAATGGGGTGGG + Intronic
1066210456 10:33232423-33232445 CTGTTTAACATTAAGGGTGATGG + Intronic
1069801886 10:71086813-71086835 CTGTTTTATGTGCAGGGGGAAGG - Intergenic
1070484459 10:76916111-76916133 CTGTTTAAGCTAAATGGAGAAGG + Intronic
1072022004 10:91411010-91411032 CTGTTTAATCTGAAGGGGGAAGG - Intronic
1072747982 10:97955181-97955203 CTGGTGAATCTGAAGGAGGGTGG - Intronic
1073065053 10:100753360-100753382 CTTTTTGCTCTGAAGAGGGAAGG + Intronic
1077661396 11:4071666-4071688 CTATTTAATTTGGAGGGGTAGGG + Intronic
1077673999 11:4181664-4181686 CTGTTTAATTTTAAGAGAGAAGG + Intergenic
1080146447 11:28990660-28990682 TTTTTTAATCTGGTGGGGGAGGG + Intergenic
1081343416 11:41955000-41955022 ATGTTTAATGAGAAAGGGGAAGG + Intergenic
1081492836 11:43580801-43580823 CTTTTTTTTCAGAAGGGGGAGGG - Intronic
1081694911 11:45102963-45102985 CTGTTTACCCTGGAGGGGGAAGG + Intronic
1082640161 11:55649956-55649978 CTGTTTGATTTGAAAGGAGAGGG - Intergenic
1084337472 11:68468409-68468431 TTGTTTACTCAGAAGGGGCAGGG - Intronic
1092984350 12:13831148-13831170 CTGCTTCCTCTGAAGGTGGAAGG - Intronic
1094032561 12:26029381-26029403 CTTTTTAATCTGTCTGGGGAAGG + Intronic
1095187560 12:39218439-39218461 CTATTTAATGAGAAGGGCGATGG + Intergenic
1095384267 12:41631693-41631715 CTGTGTAAGCTGAGGTGGGATGG + Intergenic
1097472470 12:60011522-60011544 CGGTTTAATTTGTAGGTGGATGG + Intergenic
1100888023 12:99093882-99093904 GTGTTTATTCTTAAGGGTGAAGG + Intronic
1103277746 12:119727437-119727459 CTGTGGATTCAGAAGGGGGAAGG + Intronic
1105858386 13:24390429-24390451 CCGTGTCATCTGAAGGGGAATGG - Intergenic
1106297983 13:28435518-28435540 CTTTATAATCTGTTGGGGGAAGG - Intronic
1110738385 13:78965250-78965272 TAGATTAATCTGAAGGTGGAGGG + Intergenic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113363817 13:109657039-109657061 TTGTTTAATCTGATGGAAGAAGG + Intergenic
1115123386 14:29964402-29964424 CTTCTTTATCTGAAAGGGGAAGG - Intronic
1117856976 14:60045122-60045144 CTCTTTTATTTGAAGGGGCAGGG + Intronic
1118181069 14:63493935-63493957 CTGTTTAAACTGTAGGAAGAAGG + Intronic
1119178647 14:72588573-72588595 CTCATTACTCAGAAGGGGGAAGG - Intergenic
1119882984 14:78116224-78116246 CTGCCTAATTTGAAGGTGGAGGG - Intergenic
1120993034 14:90395459-90395481 CTTTCTAATCTGCAGAGGGAAGG + Intergenic
1126072094 15:44874232-44874254 CTTTTCAAGCTGTAGGGGGAGGG - Intergenic
1126086095 15:45012434-45012456 CTCTTCAAGCTGTAGGGGGAGGG + Intergenic
1126400563 15:48264781-48264803 CTGTTTGATCCGAATGGGGTTGG + Intronic
1126666318 15:51078652-51078674 ATGTTGAATGTGGAGGGGGAGGG - Intronic
1126922972 15:53548320-53548342 CTGTTTATTCTGTAGGAGCATGG - Intronic
1133838623 16:9388562-9388584 CTGTTTAATATCATGGGGAAGGG - Intergenic
1134662490 16:15994723-15994745 CTAATTAATCTGCAGGGGGTAGG - Intronic
1139972305 16:70783724-70783746 TTGTTTAATGTGCAGGGGAATGG + Intronic
1145732683 17:27203586-27203608 TTGTTTTATCTGAAAGGTGAAGG - Intergenic
1146226611 17:31072210-31072232 TTGTTTTATCTGAAAGGGGAAGG + Intergenic
1146749572 17:35366095-35366117 CTTTTTAATTTGAAGGAGGATGG - Intronic
1148580422 17:48739460-48739482 CTGTTGAATCCGAAGTTGGATGG + Intergenic
1149012380 17:51870959-51870981 ATGTTTTGTCTGAAGGGTGAGGG - Intronic
1150256731 17:63752256-63752278 TTGTTTCTTCTCAAGGGGGAGGG - Intronic
1150740735 17:67777161-67777183 CTTATAAATCTGAAGGGGGCTGG - Intergenic
1152643225 17:81457769-81457791 CTGGGTAATCAGGAGGGGGAGGG + Intronic
1156608385 18:38696546-38696568 CTGTTTAATGTGAGGGGTGATGG + Intergenic
1157093822 18:44668237-44668259 CTGTCTATTGTGAAGAGGGAGGG - Intergenic
1159275264 18:66211132-66211154 CTGATTAATCAGAAGAAGGAGGG - Intergenic
1161024362 19:2028761-2028783 CTGTTTAAAGTGAAGTGTGATGG - Intronic
1161612639 19:5251603-5251625 CTGTTTCCTCTGTTGGGGGAGGG - Intronic
1162760892 19:12887559-12887581 CTGTTTACTGGGGAGGGGGAGGG - Intergenic
926718934 2:15944224-15944246 CTGCTTGATCTGAAGGGGACCGG - Intronic
929991569 2:46793904-46793926 CTGTTGAAACTGAAAGGGGAGGG + Intergenic
936039322 2:109137821-109137843 CTGTTTGATTTGAAGGGTCAAGG + Intronic
938600241 2:132830300-132830322 GTTTTTAATGTGGAGGGGGATGG + Intronic
939466313 2:142561801-142561823 CTTTTGAATCTGCAGGGGCAGGG - Intergenic
940197630 2:151113563-151113585 CTGTATAATCTGAAAGGGGGAGG + Intergenic
940426437 2:153536385-153536407 CTGTCCAATCTGGAGGAGGAGGG + Intergenic
941312853 2:163955690-163955712 GTGTTAAAGCTGAAGAGGGAGGG + Intergenic
941537584 2:166741987-166742009 CCGTTCAAGCTGTAGGGGGAGGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942237462 2:173925789-173925811 TTTTTTAATCTGAAGGGGAGGGG - Intronic
942455133 2:176132788-176132810 CTGTTTAATAAGAAAGGGGTGGG + Intergenic
1168907299 20:1416642-1416664 ATGTTTTAACTGAAGTGGGAAGG - Intergenic
1170138602 20:13102912-13102934 CTGTTTACCCTGCAGGGGGAGGG - Intronic
1170380706 20:15756688-15756710 TTTTATCATCTGAAGGGGGAAGG + Intronic
1172364747 20:34340332-34340354 CTGTTTAAACTGAAGTGAGTTGG + Intergenic
1174039676 20:47690072-47690094 CTGCTTAGCATGAAGGGGGAGGG - Intronic
1175534968 20:59703493-59703515 TTGTGTAATTTGATGGGGGAAGG + Intronic
1177006310 21:15676522-15676544 CTGTTTAATGTGAACAGGTAAGG + Intergenic
1177099731 21:16885430-16885452 CTGTTTCAGCTGAAGCTGGATGG + Intergenic
1178742819 21:35218723-35218745 TTGTATACTTTGAAGGGGGATGG - Intronic
1183069780 22:35387903-35387925 CTGGATTTTCTGAAGGGGGAGGG - Intronic
950099875 3:10350191-10350213 CTGCTCAATCTGGAGAGGGATGG + Exonic
950412464 3:12848027-12848049 CTGTTTTATGTGTAGGGGGAGGG - Intronic
951113313 3:18831678-18831700 CTGAGTATTCTGAAGTGGGATGG + Intergenic
951884647 3:27512201-27512223 CTGATTCATTAGAAGGGGGAAGG - Intergenic
952140263 3:30471033-30471055 CTATTTAATCTGTAGTGGGTTGG - Intergenic
957951777 3:87136452-87136474 CTGCTAGATCTGAAGGGGGAAGG - Intergenic
957994951 3:87677534-87677556 CTGTCTAATCTGGAGAGGAATGG - Intergenic
958950527 3:100411016-100411038 CTCCTTAAGCTGAAGGGGCAAGG + Intronic
959204337 3:103285242-103285264 TTGTTTTATCTGAACGTGGATGG + Intergenic
960163916 3:114380490-114380512 TTTTTTTTTCTGAAGGGGGATGG + Intronic
961261622 3:125606542-125606564 CCCTTCAATCTGTAGGGGGAGGG + Intergenic
961716812 3:128863531-128863553 CTGTTTTATGTGTAGGGGGAGGG + Intergenic
961805026 3:129483103-129483125 CTGTTTTATGTGTAGAGGGAGGG - Intronic
962970401 3:140395618-140395640 GTGTTTCATCTGAAGTGGGAGGG + Intronic
963733952 3:148998365-148998387 TTGTTACAACTGAAGGGGGAGGG + Intronic
964165776 3:153703770-153703792 CTGCTTAATCTGATGGAGGCTGG + Intergenic
967060518 3:185868331-185868353 ATCTTTAATCTGAAGGGGAGAGG - Intergenic
967216852 3:187218480-187218502 CTGTTTATTCTGTAAGGGGAAGG - Intronic
971364863 4:25969570-25969592 CTGTCCAATCAGAAGGGAGATGG + Intergenic
971448238 4:26775590-26775612 CTGTGTCATCTGATGGTGGAAGG - Intergenic
972654870 4:41054892-41054914 CTGTTTGATCGGGAGGGGCAGGG - Intronic
973209578 4:47600765-47600787 CTGTTTAATCTAACAGGGAAGGG + Intronic
977834966 4:101636088-101636110 CTTTTCAAGCTGTAGGGGGAGGG - Intronic
980234075 4:130081060-130081082 CTGTTTCATCTGTAGGGCTAGGG + Intergenic
981674444 4:147324924-147324946 CTCTCTAACCTGAAAGGGGAAGG - Intergenic
982376069 4:154692321-154692343 CTGTGAAATCTGAAGGGAGGTGG - Intronic
985488780 5:166759-166781 AGGTTTAATCTGAACGGAGAAGG + Intronic
986801942 5:11269780-11269802 CTGCATATTCTGAGGGGGGAGGG - Intronic
988978243 5:36537120-36537142 ATGTTTAAGCTGAAGAGGAATGG + Intergenic
989049466 5:37305202-37305224 CTGTTTAATCTGAAAGAAAATGG + Exonic
993147960 5:84120502-84120524 CTGTGTCATCTGAAGGAGTAAGG - Intronic
993887930 5:93438733-93438755 CTGTTTCACCTGAGGGGGAAAGG + Intergenic
995209796 5:109524684-109524706 CTGTTTTCTCTGCAGGAGGATGG - Intergenic
996238136 5:121159390-121159412 CTGTTTAATGTGAAGAGGGTGGG - Intergenic
996413454 5:123183802-123183824 CTGTTTAGTAAGAAGGAGGAAGG - Intronic
997523943 5:134540705-134540727 CTGTTCAAGTTGAAGTGGGATGG + Intronic
998111411 5:139505524-139505546 CTCTTCAAGCTGTAGGGGGAGGG + Intergenic
1000353810 5:160373922-160373944 ATGATTAATCTGAAGGTTGATGG - Intergenic
1000932843 5:167272677-167272699 CTGTTAAATCTAAGTGGGGATGG - Intergenic
1002823974 6:755867-755889 CTCTTTGACCTGAAGGGGAAAGG - Intergenic
1002914487 6:1518116-1518138 CCTTTCAATCTGAAAGGGGATGG - Intergenic
1007043971 6:38752721-38752743 AAGTTTAATATGAAAGGGGAGGG + Intronic
1007966537 6:46008549-46008571 CTGTGAAAGCTGAAGGGGGCTGG - Intronic
1009407760 6:63331037-63331059 CCCTTTAAGCTGTAGGGGGAGGG - Intergenic
1011636491 6:89379456-89379478 CTGTAAATTCTGAAGGGGGCTGG - Intronic
1011860738 6:91753022-91753044 CTGTCTGAACTCAAGGGGGAAGG + Intergenic
1013138258 6:107304130-107304152 CTGTATAATCTCAGTGGGGAAGG - Intronic
1014498436 6:122156709-122156731 GTATTTAATCTGAAGAGGAATGG - Intergenic
1015505990 6:133989023-133989045 GTGCTTTATCTGAAGGGAGAGGG + Exonic
1016005007 6:139080173-139080195 CTTTCTAATCAGAAGGAGGAGGG + Intergenic
1019415382 7:924501-924523 CTGTGTAATCTGGAGGGCGGGGG - Intronic
1019684234 7:2371754-2371776 CTGTTTAAAAAAAAGGGGGAAGG - Intronic
1019713498 7:2528014-2528036 CTGTTTTTTTTGAAAGGGGATGG + Exonic
1020550014 7:9592143-9592165 CTGTTTACTCTGAAGATAGATGG - Intergenic
1024915363 7:54493104-54493126 TTGCTTAATCTGAAAGGGGTGGG - Intergenic
1025046338 7:55695340-55695362 CAGTTTCCTCTGAAGGGGGTGGG + Intergenic
1027895388 7:84036157-84036179 TTGTTTAATCTAAAGGGAGATGG + Intronic
1029213514 7:98928395-98928417 CTGGTTGATCTTAAGGGTGAGGG - Intronic
1029642838 7:101832050-101832072 ATTTTTAAACTGAAGAGGGATGG + Intronic
1030511833 7:110492314-110492336 CTTCTTAATCTGAAAGGAGAAGG + Intergenic
1030595061 7:111527974-111527996 CTGTTTTATCTGAATTGTGAGGG + Intronic
1033801723 7:144909461-144909483 CTATTTAATCGGAAGAAGGAAGG - Intergenic
1034869862 7:154674430-154674452 CTGGTTGATCTGCAAGGGGAGGG + Intronic
1038015006 8:23507387-23507409 TTGCAAAATCTGAAGGGGGAGGG + Intergenic
1038311272 8:26448287-26448309 CTGTAAGATCTGAAGGGGGTGGG + Intronic
1039748789 8:40457666-40457688 CTGTTTTGTTTGAAGGGAGATGG - Intergenic
1044438635 8:92196349-92196371 AAGTTTTATCTGAAGGGGTAGGG + Intergenic
1044618640 8:94167384-94167406 CTGTGTCAGCTGATGGGGGAGGG - Intronic
1044931693 8:97258017-97258039 ATGTGTAAACTGTAGGGGGAGGG - Intergenic
1050630755 9:7555865-7555887 CTGTAAAAACTGAAGTGGGAGGG + Intergenic
1054870957 9:70046650-70046672 CTGTTTTCCCTGAAGGGGGATGG - Intronic
1057874563 9:98744001-98744023 CTGTTAGATGTCAAGGGGGAGGG - Intronic
1057913562 9:99038497-99038519 CTGTTTTATAAGAAGGGGGAGGG + Intronic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1058246389 9:102631559-102631581 CTTTCTAATCTGGAAGGGGATGG + Intergenic
1061476192 9:130868288-130868310 CTGATTCATCTGATGGGTGAAGG + Intronic
1062263004 9:135672142-135672164 CTGCTGGCTCTGAAGGGGGAAGG - Intergenic
1186798339 X:13067792-13067814 CTGTTTATTCTCAAGGATGAAGG + Intergenic
1188415780 X:29932245-29932267 CTTTATAATCTAAAGGGGAAAGG + Intronic
1195366605 X:104132589-104132611 TTGTTACATCTGAAGGAGGATGG - Intronic
1195994764 X:110720736-110720758 GTGTTTAAACTGAAGCAGGAAGG - Intronic
1200959244 Y:8982057-8982079 CTCTTCAAGCTGTAGGGGGAGGG + Intergenic
1201555666 Y:15262911-15262933 CCCTTCAATCTGTAGGGGGAGGG + Intergenic