ID: 1072025887

View in Genome Browser
Species Human (GRCh38)
Location 10:91456070-91456092
Sequence AAACTACTTTAAAGTTCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 24661
Summary {0: 9824, 1: 5657, 2: 3549, 3: 2611, 4: 3020}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072025887_1072025897 24 Left 1072025887 10:91456070-91456092 CCATATGAACTTTAAAGTAGTTT 0: 9824
1: 5657
2: 3549
3: 2611
4: 3020
Right 1072025897 10:91456117-91456139 TTGGTAGCCTGATGGGGGGGTGG No data
1072025887_1072025891 17 Left 1072025887 10:91456070-91456092 CCATATGAACTTTAAAGTAGTTT 0: 9824
1: 5657
2: 3549
3: 2611
4: 3020
Right 1072025891 10:91456110-91456132 AAAGCCATTGGTAGCCTGATGGG No data
1072025887_1072025890 16 Left 1072025887 10:91456070-91456092 CCATATGAACTTTAAAGTAGTTT 0: 9824
1: 5657
2: 3549
3: 2611
4: 3020
Right 1072025890 10:91456109-91456131 GAAAGCCATTGGTAGCCTGATGG No data
1072025887_1072025892 18 Left 1072025887 10:91456070-91456092 CCATATGAACTTTAAAGTAGTTT 0: 9824
1: 5657
2: 3549
3: 2611
4: 3020
Right 1072025892 10:91456111-91456133 AAGCCATTGGTAGCCTGATGGGG No data
1072025887_1072025893 19 Left 1072025887 10:91456070-91456092 CCATATGAACTTTAAAGTAGTTT 0: 9824
1: 5657
2: 3549
3: 2611
4: 3020
Right 1072025893 10:91456112-91456134 AGCCATTGGTAGCCTGATGGGGG No data
1072025887_1072025896 21 Left 1072025887 10:91456070-91456092 CCATATGAACTTTAAAGTAGTTT 0: 9824
1: 5657
2: 3549
3: 2611
4: 3020
Right 1072025896 10:91456114-91456136 CCATTGGTAGCCTGATGGGGGGG No data
1072025887_1072025894 20 Left 1072025887 10:91456070-91456092 CCATATGAACTTTAAAGTAGTTT 0: 9824
1: 5657
2: 3549
3: 2611
4: 3020
Right 1072025894 10:91456113-91456135 GCCATTGGTAGCCTGATGGGGGG No data
1072025887_1072025889 5 Left 1072025887 10:91456070-91456092 CCATATGAACTTTAAAGTAGTTT 0: 9824
1: 5657
2: 3549
3: 2611
4: 3020
Right 1072025889 10:91456098-91456120 AATTCTGTGAAGAAAGCCATTGG 0: 80
1: 10508
2: 5562
3: 4732
4: 4753

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072025887 Original CRISPR AAACTACTTTAAAGTTCATA TGG (reversed) Intronic
Too many off-targets to display for this crispr