ID: 1072025888

View in Genome Browser
Species Human (GRCh38)
Location 10:91456096-91456118
Sequence AATGGCTTTCTTCACAGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 16483
Summary {0: 81, 1: 10499, 2: 3869, 3: 1301, 4: 733}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072025888_1072025897 -2 Left 1072025888 10:91456096-91456118 CCAATTCTGTGAAGAAAGCCATT 0: 81
1: 10499
2: 3869
3: 1301
4: 733
Right 1072025897 10:91456117-91456139 TTGGTAGCCTGATGGGGGGGTGG No data
1072025888_1072025890 -10 Left 1072025888 10:91456096-91456118 CCAATTCTGTGAAGAAAGCCATT 0: 81
1: 10499
2: 3869
3: 1301
4: 733
Right 1072025890 10:91456109-91456131 GAAAGCCATTGGTAGCCTGATGG No data
1072025888_1072025891 -9 Left 1072025888 10:91456096-91456118 CCAATTCTGTGAAGAAAGCCATT 0: 81
1: 10499
2: 3869
3: 1301
4: 733
Right 1072025891 10:91456110-91456132 AAAGCCATTGGTAGCCTGATGGG No data
1072025888_1072025894 -6 Left 1072025888 10:91456096-91456118 CCAATTCTGTGAAGAAAGCCATT 0: 81
1: 10499
2: 3869
3: 1301
4: 733
Right 1072025894 10:91456113-91456135 GCCATTGGTAGCCTGATGGGGGG No data
1072025888_1072025896 -5 Left 1072025888 10:91456096-91456118 CCAATTCTGTGAAGAAAGCCATT 0: 81
1: 10499
2: 3869
3: 1301
4: 733
Right 1072025896 10:91456114-91456136 CCATTGGTAGCCTGATGGGGGGG No data
1072025888_1072025899 22 Left 1072025888 10:91456096-91456118 CCAATTCTGTGAAGAAAGCCATT 0: 81
1: 10499
2: 3869
3: 1301
4: 733
Right 1072025899 10:91456141-91456163 ATTGAATCTATAAATTAACTTGG No data
1072025888_1072025892 -8 Left 1072025888 10:91456096-91456118 CCAATTCTGTGAAGAAAGCCATT 0: 81
1: 10499
2: 3869
3: 1301
4: 733
Right 1072025892 10:91456111-91456133 AAGCCATTGGTAGCCTGATGGGG No data
1072025888_1072025900 23 Left 1072025888 10:91456096-91456118 CCAATTCTGTGAAGAAAGCCATT 0: 81
1: 10499
2: 3869
3: 1301
4: 733
Right 1072025900 10:91456142-91456164 TTGAATCTATAAATTAACTTGGG No data
1072025888_1072025893 -7 Left 1072025888 10:91456096-91456118 CCAATTCTGTGAAGAAAGCCATT 0: 81
1: 10499
2: 3869
3: 1301
4: 733
Right 1072025893 10:91456112-91456134 AGCCATTGGTAGCCTGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072025888 Original CRISPR AATGGCTTTCTTCACAGAAT TGG (reversed) Intronic
Too many off-targets to display for this crispr