ID: 1072025889

View in Genome Browser
Species Human (GRCh38)
Location 10:91456098-91456120
Sequence AATTCTGTGAAGAAAGCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25635
Summary {0: 80, 1: 10508, 2: 5562, 3: 4732, 4: 4753}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072025887_1072025889 5 Left 1072025887 10:91456070-91456092 CCATATGAACTTTAAAGTAGTTT 0: 9824
1: 5657
2: 3549
3: 2611
4: 3020
Right 1072025889 10:91456098-91456120 AATTCTGTGAAGAAAGCCATTGG 0: 80
1: 10508
2: 5562
3: 4732
4: 4753

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072025889 Original CRISPR AATTCTGTGAAGAAAGCCAT TGG Intronic
Too many off-targets to display for this crispr