ID: 1072025890

View in Genome Browser
Species Human (GRCh38)
Location 10:91456109-91456131
Sequence GAAAGCCATTGGTAGCCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072025888_1072025890 -10 Left 1072025888 10:91456096-91456118 CCAATTCTGTGAAGAAAGCCATT 0: 81
1: 10499
2: 3869
3: 1301
4: 733
Right 1072025890 10:91456109-91456131 GAAAGCCATTGGTAGCCTGATGG No data
1072025887_1072025890 16 Left 1072025887 10:91456070-91456092 CCATATGAACTTTAAAGTAGTTT 0: 9824
1: 5657
2: 3549
3: 2611
4: 3020
Right 1072025890 10:91456109-91456131 GAAAGCCATTGGTAGCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072025890 Original CRISPR GAAAGCCATTGGTAGCCTGA TGG Intronic
No off target data available for this crispr