ID: 1072025894

View in Genome Browser
Species Human (GRCh38)
Location 10:91456113-91456135
Sequence GCCATTGGTAGCCTGATGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072025887_1072025894 20 Left 1072025887 10:91456070-91456092 CCATATGAACTTTAAAGTAGTTT 0: 9824
1: 5657
2: 3549
3: 2611
4: 3020
Right 1072025894 10:91456113-91456135 GCCATTGGTAGCCTGATGGGGGG No data
1072025888_1072025894 -6 Left 1072025888 10:91456096-91456118 CCAATTCTGTGAAGAAAGCCATT 0: 81
1: 10499
2: 3869
3: 1301
4: 733
Right 1072025894 10:91456113-91456135 GCCATTGGTAGCCTGATGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072025894 Original CRISPR GCCATTGGTAGCCTGATGGG GGG Intronic
No off target data available for this crispr