ID: 1072025895

View in Genome Browser
Species Human (GRCh38)
Location 10:91456114-91456136
Sequence CCCCCCCATCAGGCTACCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 2, 3: 95, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072025895_1072025900 5 Left 1072025895 10:91456114-91456136 CCATTGGTAGCCTGATGGGGGGG 0: 1
1: 0
2: 2
3: 95
4: 176
Right 1072025900 10:91456142-91456164 TTGAATCTATAAATTAACTTGGG No data
1072025895_1072025901 13 Left 1072025895 10:91456114-91456136 CCATTGGTAGCCTGATGGGGGGG 0: 1
1: 0
2: 2
3: 95
4: 176
Right 1072025901 10:91456150-91456172 ATAAATTAACTTGGGCAGTATGG No data
1072025895_1072025899 4 Left 1072025895 10:91456114-91456136 CCATTGGTAGCCTGATGGGGGGG 0: 1
1: 0
2: 2
3: 95
4: 176
Right 1072025899 10:91456141-91456163 ATTGAATCTATAAATTAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072025895 Original CRISPR CCCCCCCATCAGGCTACCAA TGG (reversed) Intronic
901157167 1:7148696-7148718 CTCCCCCATCAGGGGACCACTGG + Intronic
901191475 1:7413297-7413319 CATCCCCATCAAGCTACCAATGG - Intronic
901863147 1:12087567-12087589 ACCAACCATCAGGCTAGCAAGGG - Intronic
902458537 1:16553933-16553955 CCCCTCCAACAGGCTACCACTGG + Intergenic
902493621 1:16853983-16854005 CCCCTCCAACAGGCTACCACTGG - Intronic
903151727 1:21414692-21414714 CCCCTCCAACTGGCTACCAGTGG + Intergenic
904038508 1:27571345-27571367 CTCCCCCATCAGACTCCCCAGGG - Intronic
906636809 1:47415807-47415829 CCTCCCCATCAGGATACTGAGGG + Intergenic
906797675 1:48710877-48710899 CCACCCCACCAGCCTACCTATGG + Intronic
907291114 1:53413604-53413626 CCCACCCCTCATGCCACCAAGGG - Intergenic
908069119 1:60439131-60439153 CATCCCCATCAAGCTACCAATGG + Intergenic
908864543 1:68531872-68531894 AAACCCCATCAGGCTAACAATGG + Intergenic
910954482 1:92686989-92687011 CATCCCCATCAAGCTACCACTGG + Intronic
911556311 1:99348995-99349017 CCCCCCCACCACACTGCCAAGGG - Intergenic
913258737 1:116979320-116979342 CATCCCCATCAAGCTACCAATGG + Intronic
914209326 1:145563713-145563735 CCCCTCCAACCGGCTACCAGTGG + Intergenic
914268245 1:146056081-146056103 CCCCTCCAACCGGCTACCAGTGG + Intergenic
914368853 1:147004780-147004802 CCCCTCCAACCGGCTACCAGTGG - Intergenic
914375336 1:147068508-147068530 CATCCCCATCAAGCTACCAATGG + Intergenic
915303686 1:154965975-154965997 CCCCCCAATCCTGCTATCAATGG - Exonic
916037986 1:160937386-160937408 CATCCCCATCAAGCTACCAAAGG - Intergenic
917908931 1:179619862-179619884 CCCCCACTTCAGCCTCCCAAAGG + Intronic
918027027 1:180760714-180760736 CATCACCATCAAGCTACCAATGG + Intronic
921717112 1:218428877-218428899 CATCCCCATCAAGCTACCAGTGG - Intronic
1064857381 10:19785016-19785038 TACTCCCATCAGACTACCAATGG + Intronic
1065254548 10:23852556-23852578 CATCCCCATCAAGCTACCAATGG - Intronic
1066144280 10:32540733-32540755 CCCACCCATCAGGCTAAAAGTGG - Intronic
1067190345 10:44063215-44063237 CCCTCCCATCAGGCTACCCATGG - Intergenic
1070153040 10:73817054-73817076 CCCCTCCACGAGGTTACCAAGGG + Exonic
1070411337 10:76144233-76144255 CATCTCCATCAAGCTACCAATGG - Intronic
1071884328 10:89933073-89933095 CATCCCCATCAACCTACCAATGG - Intergenic
1071983324 10:91025638-91025660 CATCCCCATCAAGCTACCATCGG + Intergenic
1072025895 10:91456114-91456136 CCCCCCCATCAGGCTACCAATGG - Intronic
1077101005 11:822308-822330 CCACCCCACCCGGCCACCAAGGG - Intronic
1077742184 11:4858672-4858694 CATCCCCATCAAGCTACCAATGG + Intronic
1078100141 11:8325663-8325685 CCCTCCCACCAGGCCAACAAAGG + Intergenic
1079463375 11:20705112-20705134 CATCCCCATCAAGCTACCAATGG + Intronic
1079716137 11:23748153-23748175 CACCCGCCTCAGGCTCCCAAAGG - Intergenic
1081779275 11:45698896-45698918 CCTCCCCTTCAGGCTGCAAAAGG + Intergenic
1082247851 11:49945627-49945649 CATCCCCATCAAGCTACCAATGG - Intergenic
1082314803 11:50704830-50704852 CATCCCCATCAAACTACCAATGG - Intergenic
1082316130 11:50724697-50724719 CATCCCCATCAAGCTACCAATGG + Intergenic
1082684757 11:56224044-56224066 CATCCCCATCAAGCTACCAATGG + Intergenic
1082713774 11:56588207-56588229 CATCCCCATCAAGCTACCAAGGG - Intergenic
1083337992 11:61938151-61938173 CTCCCACTTCAGCCTACCAAAGG - Intergenic
1083518257 11:63281393-63281415 AACCCCCATCAGGCTACCAATGG - Intronic
1083531134 11:63423327-63423349 CATCCCCATCAAGCTACCAATGG + Intergenic
1084418014 11:69044843-69044865 CCACCTCATTAGGCTACAAAGGG - Intergenic
1084541232 11:69788386-69788408 GCCCCCCATCAGCCTGCCAGTGG + Intergenic
1084966984 11:72750143-72750165 ACCCCGCTTCAGGCTCCCAAGGG - Intronic
1087107527 11:94425122-94425144 GAACCCCATCAGGCTACCAGCGG + Intronic
1087297080 11:96389919-96389941 CCCCCCCTTCCGGGGACCAAGGG + Intronic
1088084136 11:105957652-105957674 CATCCCCATCAAGCTACCAATGG - Intronic
1088574987 11:111262661-111262683 CCCCTCCTTCTGGCTACAAATGG + Intronic
1089408430 11:118218335-118218357 CACCCACTTCAGCCTACCAAAGG + Intronic
1091213674 11:133886191-133886213 CTCTCCCAGCAGGCTACCATGGG + Intergenic
1091421723 12:347361-347383 CATCCCCATCAAGCTACCAATGG + Intronic
1092680554 12:10975195-10975217 GAACCCCATCAGGCTAACAATGG + Intronic
1093338386 12:17938385-17938407 CACCCGCATCAGTCTCCCAAAGG + Intergenic
1093950293 12:25157983-25158005 CGCCCCCCTCAGCCTCCCAAAGG - Intronic
1095442374 12:42250448-42250470 CATCCCCATCAAGCTACCAATGG - Intronic
1095863019 12:46939911-46939933 CATCCCCATCAAGCTACCAATGG - Intergenic
1096161364 12:49380266-49380288 CTCCCACATCAGCCTCCCAAAGG + Intronic
1097016904 12:55993703-55993725 CCTCCCCATCATGCAACCAGTGG + Exonic
1097277719 12:57824499-57824521 ACCCCTCACCAGGCTTCCAATGG + Intronic
1099073263 12:78073638-78073660 CATCCCCATCAAGCTACCAATGG + Intronic
1099515682 12:83594159-83594181 CATCTCCATCAAGCTACCAATGG + Intergenic
1099651488 12:85434020-85434042 CATCCCCATCAAGCTACCAATGG + Intergenic
1099740779 12:86631354-86631376 CATCCCCATGAAGCTACCAATGG + Intronic
1100528928 12:95446678-95446700 CCACCCCAGCAGGCTAACACTGG + Intergenic
1100847891 12:98679016-98679038 CCCCACCTTCAGGCCACAAAGGG + Intronic
1101175450 12:102146165-102146187 CATCCCCATCAAGCCACCAATGG + Intronic
1101182965 12:102239850-102239872 CATCCCCATCAAGCTACCAATGG + Intergenic
1102352122 12:112200691-112200713 GGCCCCCAGCAGGCTACCGAAGG - Exonic
1102465776 12:113130151-113130173 CACCCCCATCAGGCCTCCAGGGG + Intronic
1103385995 12:120533297-120533319 CCCCCTCCTCAGACTCCCAAAGG + Intronic
1104544939 12:129702011-129702033 CAGCCCCCTCATGCTACCAATGG - Intronic
1108547574 13:51511248-51511270 CCATCCCATCAAGCTACCAATGG - Intergenic
1108882159 13:55133441-55133463 CATCCCCATCAAGCTACCAATGG - Intergenic
1108908981 13:55518942-55518964 CATGCCCATCAAGCTACCAATGG - Intergenic
1110277202 13:73653458-73653480 CCCCCCCATTAGGTTTCCATTGG - Intergenic
1110593212 13:77288160-77288182 GCCCCCTATCAAGCTTCCAAAGG - Exonic
1111273120 13:85913324-85913346 CATCCCCATCAAGCTACCAATGG - Intergenic
1113763924 13:112869127-112869149 GCCCCACTTCAGGCCACCAAGGG + Intronic
1114756398 14:25264775-25264797 CGCCCTCATCAGCCTCCCAAAGG - Intergenic
1117876197 14:60251912-60251934 CCTTCACATCAGACTACCAAGGG - Intronic
1120717767 14:87858615-87858637 CATCCCCATCAAGCTACCAATGG + Intronic
1120742518 14:88123748-88123770 CATCCCCATCTAGCTACCAATGG - Intergenic
1121552052 14:94810196-94810218 CTCCCACATCAGGCTCCCAAAGG - Intergenic
1121925243 14:97921260-97921282 CCCACCCATCAGCCCACCAGAGG + Intergenic
1122316215 14:100827358-100827380 CCCCTCCATCAGGAGAACAAAGG - Intergenic
1122415316 14:101546875-101546897 CCCCCCCAGCAGGCCTGCAAGGG - Intergenic
1123176917 14:106428724-106428746 CATCCCCATCAAGCTACCAATGG + Intergenic
1124408625 15:29416096-29416118 CATCCCCATCAAGCTACCAATGG + Intronic
1127097295 15:55525715-55525737 GAACCCCATCAGGCTAACAATGG - Intergenic
1127123289 15:55789351-55789373 CTTCACCATCAGGCTCCCAACGG - Intergenic
1130165972 15:81459139-81459161 CCACCCCATCAGGCTAACAGTGG - Intergenic
1131240691 15:90740007-90740029 CCCCCGCCTCAGCCTTCCAAAGG + Intronic
1132277149 15:100577623-100577645 CATCCCCATCAAGCTACCAATGG + Intronic
1132540395 16:505742-505764 CCCCCTCAGCCGGCTTCCAACGG - Intronic
1133325641 16:4940669-4940691 CCCCCCAATCAGGATGTCAAGGG - Intronic
1133449700 16:5893560-5893582 CACCCGCCTCAGCCTACCAAAGG - Intergenic
1138875181 16:60940506-60940528 CATCCCCATCAAGCTACCAATGG + Intergenic
1139863557 16:70046007-70046029 CATCCCCATCAAGCTACCAATGG + Intergenic
1143225025 17:5294151-5294173 CCCCCGCCTCAGCCTCCCAAAGG - Intronic
1144294441 17:13860041-13860063 CATCCCCATCAAGCTGCCAATGG + Intergenic
1144606442 17:16669936-16669958 CACCCCCCTCAGCCTCCCAAAGG - Intergenic
1144740665 17:17580525-17580547 TCCCCCCACCAGGCTGTCAAGGG - Intronic
1148699999 17:49581544-49581566 CCCCCACATCATGCTTCCAGGGG + Intronic
1151694051 17:75705101-75705123 CCCTCCCTTCAGGCTACAAAGGG - Intronic
1152288241 17:79424607-79424629 CTCCCCCACCAGGCTTCCAAGGG + Intronic
1152346222 17:79753606-79753628 CTCCCCCCTCAGCCTCCCAAAGG - Intergenic
1153490068 18:5638105-5638127 CCTCCTCATGAGGCTACCTATGG + Intergenic
1154464130 18:14627227-14627249 CCCCCCCATCAGTATACTCAAGG - Intergenic
1155093519 18:22534105-22534127 CATCCCCATCAAGCTACCAATGG + Intergenic
1160296404 18:77641711-77641733 CATCCCCATCAAGCTACCAACGG + Intergenic
1160445930 18:78926652-78926674 CGCTCCCCTCAGGCTACCAAAGG - Intergenic
1161916753 19:7234151-7234173 CGCCCACCTCAGGCTCCCAAAGG + Intronic
1165926930 19:39332410-39332432 CTCCCGCCTCAGGCTCCCAAAGG + Intronic
1166565238 19:43760980-43761002 CCACCCCATCAGCCTCCCAAAGG + Intergenic
1202708996 1_KI270714v1_random:6176-6198 CCCCTCCAACCGGCTACCAGTGG - Intergenic
928084503 2:28337352-28337374 ACCCCACATCAGGGCACCAATGG - Intronic
929540765 2:42818823-42818845 CACCCCCATCAGCCTCCCAAAGG - Intergenic
930457887 2:51630012-51630034 CATCCCCATCAAGCTACCAATGG + Intergenic
931279302 2:60774608-60774630 CACCCACCTCAGCCTACCAAAGG + Intronic
932340713 2:70961218-70961240 CCCCTCCTTCAGGCCACCCAGGG - Intronic
932642674 2:73465045-73465067 CATCCCCATCAAGCTACCAGTGG + Intronic
932928333 2:76003325-76003347 CATCCCCATCAAGCTACCAATGG + Intergenic
933042573 2:77487645-77487667 CCCCACCTTCAGGCCACCAAAGG + Intronic
933042582 2:77487674-77487696 CCCCACCTTCAGGCCACCAAAGG + Intronic
934314645 2:91905928-91905950 CATCCCCATCAAGCTACCAATGG + Intergenic
935392470 2:102567898-102567920 CATCCCCATCAAGCTACCAATGG - Intergenic
942952449 2:181736267-181736289 CATCCCCGTCAAGCTACCAATGG + Intergenic
944267153 2:197741022-197741044 CATCCCCATCAAGCTACCAATGG - Intronic
948798662 2:240420232-240420254 CCCCCCCATCAAGCTTCCTTGGG - Intergenic
1168964641 20:1892093-1892115 CCCTCACATCAGTCTACCCATGG + Intergenic
1169258246 20:4115390-4115412 CCACCCCACCTGGCTGCCAAGGG + Intergenic
1170651580 20:18247527-18247549 CATCCCCATCAAGCTACCAATGG + Intergenic
1170754591 20:19188608-19188630 CATCCCCATCAAGCTACCAATGG - Intergenic
1171527884 20:25830117-25830139 TCTCCCCATCAGGCTTCCATCGG + Intronic
1171548942 20:26025763-26025785 TCTCCCCATCAGGCTTCCATCGG - Intergenic
1171795702 20:29565493-29565515 CCCACCCATCCAGCTACCAATGG + Intergenic
1172594692 20:36142681-36142703 CAGCCCCATCAGGCCACCCAGGG - Intronic
1175930541 20:62491867-62491889 CACCCCCACCAGGCTCCCAGGGG + Intergenic
1177166465 21:17610957-17610979 CCCCTCCATCAGGCTATCTGCGG - Intronic
1177202421 21:17972742-17972764 CATCCCCATCAAGCTACCATTGG + Intronic
1178892958 21:36535144-36535166 CCGCCCCCTCAGCCTCCCAAAGG - Intronic
1178903980 21:36621116-36621138 CATGCCCATCAAGCTACCAATGG + Intergenic
1181340362 22:22174332-22174354 CATCCCAATCAAGCTACCAATGG - Intergenic
1182934319 22:34206729-34206751 CACCCCCTTCAGGGTATCAAGGG - Intergenic
949302686 3:2602689-2602711 CATCCCCATCAAGCTACCAATGG + Intronic
949629902 3:5913574-5913596 CATCCCCATCAAGCTACCAATGG - Intergenic
949631965 3:5938276-5938298 CATCCCCATCAAGCTACCAATGG + Intergenic
950081654 3:10226671-10226693 CACCCACATCAGTCTCCCAAAGG - Intronic
950579341 3:13852413-13852435 CCCTCCCAACAGGCTGCCATGGG - Intronic
951052438 3:18109497-18109519 CATACCCATCAAGCTACCAATGG + Intronic
951562471 3:23982248-23982270 CCCCACCTTCAGGCTACAGAGGG - Intergenic
951703502 3:25521122-25521144 CTCCCCCATCAGGCAAGGAAAGG + Intronic
952575332 3:34767671-34767693 CATCCCCATCAAGCTACCAATGG + Intergenic
952848591 3:37709598-37709620 CCCGCCCATCTGCCAACCAAGGG - Intronic
953891742 3:46756251-46756273 CCACCCCACCAGGCTGCCCAGGG + Exonic
954332863 3:49900178-49900200 ACCCCCCTTCAGGGTACAAAAGG + Intronic
956589018 3:70894022-70894044 CATCCCCATCAAGCTACCAATGG - Intergenic
957465866 3:80589787-80589809 CATCCCCATCAAGCTACCAATGG - Intergenic
958204366 3:90370917-90370939 CATCCCCATCAAGCTACCAATGG - Intergenic
958749544 3:98178683-98178705 CATCCCCAACAAGCTACCAATGG + Intronic
959046288 3:101477604-101477626 CACCCACATCAGCCTCCCAAAGG - Intronic
959307877 3:104692486-104692508 CATCCCCATCAAGCTACCATTGG - Intergenic
960759159 3:121053192-121053214 CATCCCCATCAAACTACCAATGG + Intronic
961861170 3:129917840-129917862 CCCTCCATTCAGGCTCCCAAAGG - Intergenic
962514691 3:136139449-136139471 CCCCCCCCTCGGCCTCCCAAAGG - Intronic
966546941 3:181159690-181159712 CATCCCCATCAAGCTACCAATGG + Intergenic
969497461 4:7534331-7534353 CCCCCCCATCAGGGAGCCACAGG + Intronic
970014707 4:11500416-11500438 TATCCCCATCAAGCTACCAATGG - Intergenic
974218381 4:58930806-58930828 CATCCCCATCAAGCTACCAATGG + Intergenic
974705316 4:65507408-65507430 CATCCCCATTAAGCTACCAATGG - Intronic
974731794 4:65876737-65876759 CATCCCCATCAAGCTACCAATGG + Intergenic
974749076 4:66113528-66113550 CATCCCCATCAAGCTACCAATGG + Intergenic
975474630 4:74809301-74809323 CATCCCCATCAAGCTACCAATGG + Intergenic
975587334 4:75963430-75963452 CATCCCCATCAAGCTACCAGTGG - Intronic
976414706 4:84759345-84759367 CATCCCCATCAAGCTACCAATGG - Intronic
977455616 4:97256139-97256161 CATCCCCATCAAGCTATCAATGG - Intronic
978412113 4:108436963-108436985 CATCCCCATCAAGCTACCAGTGG - Intergenic
980312104 4:131144031-131144053 CATCCCCATCAAGCTACCAATGG + Intergenic
983174077 4:164567689-164567711 CATCCCCATCAAGCTACCAATGG + Intergenic
983296175 4:165872287-165872309 CTCCCCCAACAAGCTTCCAAGGG - Intergenic
983377819 4:166952533-166952555 CATCCCCATCAAGCTACAAATGG + Intronic
983593874 4:169443800-169443822 CACCCCCAACAGACTAACAATGG + Intronic
983691252 4:170471989-170472011 CATCCCCATCGAGCTACCAATGG - Intergenic
986308284 5:6531836-6531858 CCTCCCCACCATGCAACCAACGG - Intergenic
986476947 5:8143822-8143844 CATCCCCATCTGGCTACAAAGGG + Intergenic
987831902 5:23105408-23105430 CCACCCAATCATGCTACCCAGGG + Intergenic
987973259 5:24978247-24978269 CATCCCCATCAAGCTACCAATGG - Intergenic
988288298 5:29250723-29250745 CACCCGCCTCAGGCTCCCAAAGG - Intergenic
989214918 5:38893951-38893973 GACCCCCATCAGGCTAACAGTGG + Intronic
991224718 5:64256743-64256765 CATCCCCATCAAGCTACCAATGG - Intronic
991945422 5:71894417-71894439 TTCACCCATCAGGCTGCCAATGG + Intergenic
992811437 5:80392672-80392694 CATCCCCATCAAGCTACCACTGG - Intergenic
993012905 5:82504129-82504151 CATCCCCATCAAGCTACCAATGG - Intergenic
996922564 5:128786244-128786266 CACCCACCTCAGGCTCCCAAAGG - Intronic
997650184 5:135511489-135511511 CACCCCCCTCAGCCTCCCAAAGG - Intergenic
999109031 5:149100369-149100391 AACCCCCATCAGACTAACAATGG + Intergenic
999867359 5:155715485-155715507 CATCCCCATCAAGCTACCAATGG - Intergenic
1002518072 5:179774134-179774156 CCCCCGCCACAGGCCACCAATGG + Exonic
1003239399 6:4330280-4330302 CATCCCCATCAAGCTATCAATGG - Intergenic
1006436290 6:34027645-34027667 CCACCCCACCGGGTTACCAAAGG + Intronic
1009998106 6:70919829-70919851 TCCCCCAATCAGGCTACACAGGG + Intronic
1010521699 6:76846030-76846052 TATCCCCATCAAGCTACCAATGG - Intergenic
1010546175 6:77159204-77159226 CATCCCCATCAAGCTACCAATGG + Intergenic
1012202583 6:96424414-96424436 CCCCCCCATCAGAGGACCAGAGG - Intergenic
1013909312 6:115254676-115254698 CATGCCCATCAAGCTACCAATGG + Intergenic
1014157335 6:118126522-118126544 CATCCCCATCAAGCTACCAATGG - Intronic
1014345499 6:120264936-120264958 CATCCCCATCAAGCTACCAATGG - Intergenic
1018055962 6:160052533-160052555 CATCCCCATCAAGCTACCAATGG + Intronic
1018987061 6:168645807-168645829 CCCTCACATCAGGCCAGCAAAGG + Intronic
1019666236 7:2253526-2253548 CCCACCCATCGGGCTCCAAAGGG + Exonic
1020778211 7:12483623-12483645 CTCCCGCCTCAGGCTTCCAAAGG - Intergenic
1023622360 7:42086692-42086714 CCCCTCCATCAGGCTTCCCAGGG + Intronic
1024699769 7:51894381-51894403 CATCCCCATCAAGCTAGCAATGG + Intergenic
1026868824 7:73838608-73838630 CAGCCCCATCAGGCTGCCCATGG - Intronic
1026947051 7:74323354-74323376 CTCCCACCTCAGCCTACCAAAGG + Intronic
1027961850 7:84956050-84956072 CATCCCCATCAAGCTACTAATGG + Intergenic
1029057818 7:97764996-97765018 CATCCCCATCAAGCTATCAATGG + Intergenic
1030982440 7:116201920-116201942 ACCTCCCATAGGGCTACCAAAGG - Intergenic
1031143162 7:117968148-117968170 CATCCCCATCAAGCTACCAATGG + Intergenic
1036094449 8:5708314-5708336 CATCCCCATCAAGCTACCAATGG - Intergenic
1036514150 8:9428273-9428295 CATCCCCATCAAGCTACCAATGG - Intergenic
1037990287 8:23316908-23316930 CCTCCCCACCGGGCTCCCAAGGG - Intronic
1040483050 8:47843671-47843693 GAACCCCATCAGGCTACCAGCGG + Intronic
1042171347 8:65994391-65994413 CATCCCCATCAAGCTACCAATGG - Intergenic
1042630724 8:70812892-70812914 CATCCCCATCAAGATACCAATGG + Intergenic
1042833881 8:73060346-73060368 CATCCCCATCAAGCTACCAATGG + Intergenic
1043617506 8:82144914-82144936 CATCCCCATCAAGCTACCAATGG - Intergenic
1044960364 8:97524567-97524589 CATCCCCATCAAGCTACCAATGG - Intergenic
1045314023 8:101027758-101027780 CCCCCACACCATGCTTCCAAGGG - Intergenic
1046465314 8:114594233-114594255 CGCCCGCCTCAGGCTCCCAAAGG - Intergenic
1047604526 8:126461852-126461874 CATCCCCATCAAGCTACCACTGG + Intergenic
1047952532 8:129946949-129946971 ACCCCCCATCACCCTTCCAAAGG + Intronic
1048109816 8:131455362-131455384 CTACCCCATTAGGCTACCAGTGG + Intergenic
1048233622 8:132668684-132668706 CACCCCCCTCAGCCTCCCAAAGG + Intronic
1050232184 9:3538284-3538306 CATCCCCATCAAGCTACCAATGG - Intergenic
1051878989 9:21820674-21820696 CATCCCCATCAAGCTACCAATGG - Intronic
1051885854 9:21891901-21891923 GACCCCCATCAGGCTAACAATGG + Intronic
1055578741 9:77686307-77686329 CATCCCCATCAAGCTACCAATGG - Intergenic
1055807858 9:80116945-80116967 TCTCCCCATTAGGCTACCCAGGG + Intergenic
1056229811 9:84531680-84531702 CATCCCCATCAAGCTACCAATGG - Intergenic
1056284394 9:85073207-85073229 CATCCCCATCAAGCTACCAATGG - Intergenic
1058409740 9:104718495-104718517 CATCCCCATCAAGCTACAAATGG + Intergenic
1061445368 9:130634357-130634379 CTCCCCAATCAGCCTTCCAAAGG - Intronic
1186122211 X:6375338-6375360 CCCCTCCTTAAGGCTCCCAATGG + Intergenic
1187946074 X:24427367-24427389 CCCCACCCTCAAGCCACCAAAGG + Intergenic
1190615550 X:52226563-52226585 CATCCCCATCAAGCTACCAATGG + Intergenic
1191647389 X:63496686-63496708 CATCCCCATCAAGCTCCCAATGG + Intergenic
1192265352 X:69533835-69533857 CCCCACCTTCAGGCCAGCAAGGG - Intergenic
1192892079 X:75400756-75400778 GATCCCCATCAGGCTAACAATGG + Intronic
1193085650 X:77446485-77446507 AGCCCCCACCAGGCTTCCAATGG + Intergenic
1194502124 X:94694385-94694407 CAACCCCATCAGGCTAGCAGTGG - Intergenic
1194612032 X:96056293-96056315 CATCCCCATCAAGCTACCAATGG - Intergenic
1194828764 X:98595541-98595563 CATCCCCATCAAGCTACCAATGG - Intergenic
1195611883 X:106876806-106876828 CACCACTATCAGGCCACCAAGGG + Intronic
1196019503 X:110975559-110975581 CATCCCCATCAAGCTACCAATGG + Intronic
1196152490 X:112390683-112390705 GAACCCCATCAGGTTACCAAAGG - Intergenic
1196515334 X:116604584-116604606 GAGCCCCATCAGGCTAACAATGG - Intergenic
1199183039 X:144880336-144880358 GAACCCCATCAGGCTAACAATGG + Intergenic
1199687225 X:150275115-150275137 CCACCACATCTGGCTGCCAATGG + Intergenic
1199842852 X:151667922-151667944 CGTCCCCATCAAGCTACCAATGG - Intronic
1199914943 X:152329296-152329318 CATCCCCATCAAGCTACCAATGG + Intronic
1200405536 Y:2807104-2807126 CATCCCCATGAAGCTACCAATGG - Intergenic
1200877716 Y:8175909-8175931 TTTCCCCATCAAGCTACCAATGG + Intergenic
1201436905 Y:13968901-13968923 CATCCCCATCAAGCTACCAACGG - Intergenic
1201740644 Y:17321302-17321324 CATCCCCATCAAGCTACCAATGG - Intergenic
1202256312 Y:22924369-22924391 CATCGCCATCAAGCTACCAATGG + Intergenic
1202409302 Y:24558122-24558144 CATCGCCATCAAGCTACCAATGG + Intergenic
1202461479 Y:25111956-25111978 CATCGCCATCAAGCTACCAATGG - Intergenic