ID: 1072025898

View in Genome Browser
Species Human (GRCh38)
Location 10:91456124-91456146
Sequence TTCAATGCCACCCCCCCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072025898_1072025900 -5 Left 1072025898 10:91456124-91456146 CCTGATGGGGGGGTGGCATTGAA 0: 1
1: 0
2: 1
3: 6
4: 127
Right 1072025900 10:91456142-91456164 TTGAATCTATAAATTAACTTGGG No data
1072025898_1072025901 3 Left 1072025898 10:91456124-91456146 CCTGATGGGGGGGTGGCATTGAA 0: 1
1: 0
2: 1
3: 6
4: 127
Right 1072025901 10:91456150-91456172 ATAAATTAACTTGGGCAGTATGG No data
1072025898_1072025899 -6 Left 1072025898 10:91456124-91456146 CCTGATGGGGGGGTGGCATTGAA 0: 1
1: 0
2: 1
3: 6
4: 127
Right 1072025899 10:91456141-91456163 ATTGAATCTATAAATTAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072025898 Original CRISPR TTCAATGCCACCCCCCCATC AGG (reversed) Intronic
900244697 1:1631640-1631662 CTCACTGCCACGTCCCCATCCGG + Intergenic
900415456 1:2532552-2532574 CTCAGTGCCACCCCCATATCTGG - Intergenic
900946672 1:5834722-5834744 TTCCATGCCACCCCACCAGGTGG - Intergenic
901388298 1:8925678-8925700 TTCATTCCCACACCACCATCTGG + Intergenic
904056421 1:27673526-27673548 TTCAGTGCCACCCCCAAATGGGG + Intergenic
904483067 1:30806185-30806207 TCCAATGCCAATCCTCCATCCGG + Intergenic
906405064 1:45535302-45535324 TTCACTGCCACCTCCGCCTCTGG + Intergenic
906476644 1:46173689-46173711 TTCACTGCCCCTCCCCCTTCAGG - Intronic
911674236 1:100640863-100640885 ATGCATGCCACACCCCCATCTGG - Intergenic
912803986 1:112741671-112741693 TTCAGTTTCACCCACCCATCGGG - Intergenic
917829499 1:178865011-178865033 TTTAATGCCACCACCTGATCTGG - Exonic
920805234 1:209227391-209227413 TACAAAGCCACTCCACCATCTGG - Intergenic
920963632 1:210684662-210684684 TCCAATGCCACCCACAGATCTGG + Intronic
1072025898 10:91456124-91456146 TTCAATGCCACCCCCCCATCAGG - Intronic
1074113451 10:110438436-110438458 GTCCATGCCACCCACCCAGCTGG + Intergenic
1077441053 11:2569444-2569466 TCCCATGCCACGCCCCCACCAGG - Intronic
1083028039 11:59567007-59567029 TTCAATGCTACCTCCACATGAGG + Intergenic
1083379495 11:62253836-62253858 CAAAATGGCACCCCCCCATCAGG + Intergenic
1085005631 11:73086332-73086354 TTCACTGCTACCCCCACCTCTGG - Intronic
1091803242 12:3338409-3338431 ATCATTCCCAACCCCCCATCAGG + Intergenic
1092629508 12:10363163-10363185 TTCAACGCCCCCCTCCCATGGGG - Intergenic
1093229758 12:16529448-16529470 TTAAATACCACCCCTTCATCTGG + Intronic
1093638956 12:21503017-21503039 CACACTGCCACCCCCCAATCAGG + Intronic
1096085322 12:48861759-48861781 TTCAATACCACCCTCCCTTGCGG + Intronic
1098922078 12:76311917-76311939 TTCAATGCCACCCTCACTTCTGG - Intergenic
1101079105 12:101163602-101163624 TTCAATGCAACCTCCACCTCTGG - Intronic
1101989461 12:109473089-109473111 TTGGATGCCACAGCCCCATCAGG + Intronic
1102570614 12:113825022-113825044 TCCAATGCCACCCCACCCCCTGG + Intronic
1104659761 12:130602425-130602447 TTCAATGCCCTCCGCCCATTTGG + Intronic
1106576886 13:30983023-30983045 TTCAACTCCACCCCCCAATCAGG - Intergenic
1106747100 13:32717161-32717183 TGCCAGGCCACCACCCCATCTGG + Intronic
1108556847 13:51601790-51601812 TACAATGCCACCTCTCCATGAGG + Intronic
1121643322 14:95500797-95500819 TCCAAGGCCACCCACCCAACTGG + Intergenic
1122507045 14:102238346-102238368 TTCATTCCCACGCCACCATCTGG + Intronic
1123940540 15:25214498-25214520 AACAATGCCACCCCCCAACCAGG - Intergenic
1127837038 15:62798173-62798195 TTCATTTCCCCACCCCCATCTGG - Intronic
1128129910 15:65219664-65219686 TTCACTGCCACCTCCGCCTCCGG + Intergenic
1129716042 15:77851533-77851555 ATCAATGCCACAGCTCCATCTGG - Intergenic
1129905189 15:79182362-79182384 TTCAAGGCCAGCCCCCAAGCTGG - Intergenic
1135184109 16:20299937-20299959 TTCAATTCCTCCCCTCCTTCTGG - Intergenic
1139654191 16:68377382-68377404 GTCAATGCCACACACCCACCAGG - Intronic
1140179396 16:72698968-72698990 CTCACTGCCACCCCCACCTCTGG - Intergenic
1140960046 16:79902954-79902976 TTCAATGCCACACACCCTTAAGG - Intergenic
1142006628 16:87692411-87692433 TTCAGTGCCACCCCCTCACAGGG + Intronic
1144996120 17:19270405-19270427 GACAATGCCACCCACCCCTCTGG + Intronic
1146187714 17:30736251-30736273 TTCCCGGCCACCACCCCATCTGG - Intergenic
1146494463 17:33308927-33308949 CTCAATGCCAAACCCCCATATGG - Intronic
1147388537 17:40095730-40095752 TTCAATGCCAACCATGCATCAGG - Exonic
1151202560 17:72479355-72479377 TTCAATGCCACAGCCACATCAGG + Intergenic
1151368058 17:73629983-73630005 GTCAATACCAACCCCCCACCAGG + Intronic
1151952363 17:77362165-77362187 GTGAAGGCCACCCCACCATCTGG - Intronic
1151963279 17:77418731-77418753 TGCAAAGCCACCCTCCCCTCGGG + Intronic
1153742291 18:8141177-8141199 GTCAGTGACACCCACCCATCAGG + Intronic
1156549005 18:37995386-37995408 CTCGATGCCAGCCCCCCTTCAGG + Intergenic
1157484936 18:48080080-48080102 TTGAATGTCACTCCCCCACCAGG - Intronic
1160658629 19:287931-287953 GGCTGTGCCACCCCCCCATCAGG + Intronic
1166364686 19:42272546-42272568 TTGGATGCCACACCCCCACCAGG + Intronic
1166607175 19:44154211-44154233 TTGAAAGCCACCCCCACAGCAGG - Intronic
1167254169 19:48417388-48417410 CTCAAAGCCACCAGCCCATCTGG - Intronic
1168108835 19:54180772-54180794 TCCAATGCCCACCCCCCAGCAGG - Exonic
925776167 2:7338230-7338252 TGCCAGGCCACCACCCCATCTGG - Intergenic
926152023 2:10430532-10430554 GTCCATGCCACCCACCCAGCAGG + Intergenic
926941127 2:18138285-18138307 GTCAATGACACCCCCACCTCAGG + Intronic
930727942 2:54699285-54699307 TTCCCGGCCACCACCCCATCTGG + Intergenic
936082135 2:109439502-109439524 TGAAATGCCTCCCACCCATCGGG - Intronic
945321689 2:208431743-208431765 TTCAATTTCTCCACCCCATCAGG + Intronic
946281183 2:218666581-218666603 TTCAATATCACTCCCCCATGGGG + Intronic
948028833 2:234800101-234800123 TATAATGCCACCCACCCACCTGG - Intergenic
1169076674 20:2764209-2764231 GTCGATGCCTCGCCCCCATCAGG - Intergenic
1170983686 20:21238866-21238888 TTCAAGGGCACCCACTCATCAGG + Intronic
1174503185 20:51000382-51000404 TTAAATGCCACCTCCTCAGCAGG + Intergenic
1174524916 20:51163190-51163212 TTCACTGCCAACCCCCCAGGTGG + Intergenic
1174709384 20:52688652-52688674 TTGAGTTCCACCCACCCATCTGG - Intergenic
1175518773 20:59586224-59586246 TTCATTGCCACTCCCCCAGAGGG + Intronic
1176071867 20:63231138-63231160 TGCCCTGCCACGCCCCCATCTGG - Intergenic
1177792168 21:25733603-25733625 TTCAATGCCACTTTCCCTTCTGG + Intronic
1177811240 21:25926860-25926882 TACAGTGCCACCACCACATCTGG - Intronic
1178622721 21:34190702-34190724 TGCAAAGCCACCCCCGCTTCAGG + Intergenic
1178929359 21:36804218-36804240 TTCAATGCAACGCTCCCAGCAGG + Intronic
1181028417 22:20138533-20138555 TCCAAGGCCACCCCCTCTTCCGG - Intronic
1181289456 22:21780331-21780353 TTAAATGCCACTCCCCCATTTGG + Intronic
1184892252 22:47387260-47387282 TTCAACGTCACCTCCCCTTCCGG - Intergenic
953865730 3:46581581-46581603 TTCACTGCAACCTCCGCATCCGG + Exonic
956605255 3:71067064-71067086 TTAAATGCCACCTCCCCAGTGGG - Intronic
959201609 3:103254848-103254870 TGCCAGGCCACCACCCCATCTGG - Intergenic
963112578 3:141699484-141699506 TTCATTCCCACACCGCCATCTGG - Intergenic
963730409 3:148965828-148965850 TTCTATTCTACCCTCCCATCAGG + Intergenic
963959391 3:151292358-151292380 CTCACTGCAACCTCCCCATCTGG + Intronic
964978706 3:162650999-162651021 TTCAGTGCAACCTCCCCTTCCGG + Intergenic
969641107 4:8399308-8399330 TACAATGCCCACTCCCCATCGGG - Intronic
969894964 4:10295154-10295176 TTTATTGCCACCCACCCTTCAGG - Intergenic
973075038 4:45914278-45914300 TTCAATTCCGCCTTCCCATCAGG + Intergenic
984037977 4:174692410-174692432 TTCCCGGCCACCACCCCATCTGG + Intronic
984074419 4:175157155-175157177 TTCAGTCCCACCCCACCTTCTGG - Intergenic
984815164 4:183829657-183829679 TTCAATTCCAGCCCCACCTCAGG + Intergenic
986565351 5:9108191-9108213 TTGAATGCCACCCCCGCATTGGG + Exonic
990293974 5:54381703-54381725 TGCCAGGCCACCACCCCATCTGG + Intergenic
991393827 5:66182149-66182171 TTCAATGCCATCCCTCCAAAGGG - Exonic
992053808 5:72967209-72967231 CTCACTGCTACCTCCCCATCCGG - Intronic
995183041 5:109246709-109246731 TTCATGGCCTCCGCCCCATCAGG - Intergenic
995806644 5:116060224-116060246 TTCACTGCAACCCCCGCCTCTGG + Intergenic
995888496 5:116922733-116922755 TTCAATACCACCACCCCCACTGG - Intergenic
997198789 5:131997369-131997391 CTCAATGCCAGCCCCTCATGTGG + Intronic
998544717 5:143016930-143016952 TTTAATGCAAACCCCCCATAAGG + Intronic
1000232269 5:159327289-159327311 TTAAATGCCTCCCCGCCAGCTGG + Intronic
1001306705 5:170579872-170579894 TGGAATGCCACCCCCCACTCAGG - Intronic
1001531830 5:172468455-172468477 TTCCCTCCCACCCCCCCAACTGG + Intergenic
1006410589 6:33871142-33871164 TTCAATGCCACCCCCACAGCTGG + Intergenic
1007212822 6:40210690-40210712 TTCAATGTCACCCCAACTTCTGG + Intergenic
1007721031 6:43885600-43885622 TTCAAAGCCCCAGCCCCATCTGG + Intergenic
1010283875 6:74051884-74051906 TGCAATGCCAGCTCCCCAACAGG + Intergenic
1012728366 6:102846010-102846032 CTCACTGCAACCTCCCCATCCGG - Intergenic
1015217673 6:130768648-130768670 TTCAATGCCACAGTCCCATGTGG + Intergenic
1015676271 6:135753504-135753526 CTCAATACAACCTCCCCATCTGG - Intergenic
1017643351 6:156515682-156515704 TATAATGCCACCCCACCTTCAGG + Intergenic
1017712991 6:157186512-157186534 TTCACTGCCACCCACACAGCAGG + Intronic
1018486907 6:164249806-164249828 TTCAATGCCCCCTTTCCATCAGG - Intergenic
1022074977 7:26959396-26959418 TGCAATGCCACCCCCTAATCTGG + Intronic
1022533220 7:31079769-31079791 TTCAATGCCACCCTCCTCCCGGG - Intronic
1022599429 7:31743021-31743043 TCCAATGCCACCCCCTAGTCTGG + Intergenic
1025875433 7:65476685-65476707 CTCAAAGGCATCCCCCCATCGGG + Intergenic
1026949416 7:74337502-74337524 TTACAAGCCACCCCCCCACCAGG - Intronic
1031567848 7:123321859-123321881 TCCAATGCCCACCCCCCACCCGG - Intergenic
1037745595 8:21641727-21641749 TGCAAGGCCACCCCCCTTTCAGG - Intergenic
1039607190 8:38891132-38891154 TCCACTGCCATCCCCCCACCAGG + Intergenic
1040499320 8:47993077-47993099 TTCATTCCCACGCCACCATCTGG - Intergenic
1048380718 8:133862676-133862698 TTAAATACCACCCATCCATCTGG + Intergenic
1049957976 9:711120-711142 CTCAAAGCCACCTCCCCCTCTGG + Exonic
1051774954 9:20622700-20622722 CTCCCTGCCACCCCCCCAGCAGG - Intergenic
1189240864 X:39523306-39523328 TTCAAGGCCAGCCCAGCATCTGG + Intergenic
1189285468 X:39849300-39849322 TTCTTTGCCACCCCCTGATCAGG - Intergenic
1189569924 X:42285557-42285579 TGCCAGGCCACCACCCCATCTGG - Intergenic
1191881355 X:65846472-65846494 TTCACTGCCCCTTCCCCATCGGG - Intergenic
1195975520 X:110522027-110522049 TTCACTGCAACCTCCGCATCCGG + Intergenic
1199536692 X:148910672-148910694 TTCACTGCCTGCACCCCATCAGG - Intronic