ID: 1072025899

View in Genome Browser
Species Human (GRCh38)
Location 10:91456141-91456163
Sequence ATTGAATCTATAAATTAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072025888_1072025899 22 Left 1072025888 10:91456096-91456118 CCAATTCTGTGAAGAAAGCCATT 0: 81
1: 10499
2: 3869
3: 1301
4: 733
Right 1072025899 10:91456141-91456163 ATTGAATCTATAAATTAACTTGG No data
1072025898_1072025899 -6 Left 1072025898 10:91456124-91456146 CCTGATGGGGGGGTGGCATTGAA 0: 1
1: 0
2: 1
3: 6
4: 127
Right 1072025899 10:91456141-91456163 ATTGAATCTATAAATTAACTTGG No data
1072025895_1072025899 4 Left 1072025895 10:91456114-91456136 CCATTGGTAGCCTGATGGGGGGG 0: 1
1: 0
2: 2
3: 95
4: 176
Right 1072025899 10:91456141-91456163 ATTGAATCTATAAATTAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072025899 Original CRISPR ATTGAATCTATAAATTAACT TGG Intronic
No off target data available for this crispr