ID: 1072027818

View in Genome Browser
Species Human (GRCh38)
Location 10:91480092-91480114
Sequence CACTTAACTGAGATGTAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 123}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072027818_1072027824 8 Left 1072027818 10:91480092-91480114 CCCTGTTACATCTCAGTTAAGTG 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1072027824 10:91480123-91480145 CTGAAGGGTTAAGGCCAAACTGG No data
1072027818_1072027825 9 Left 1072027818 10:91480092-91480114 CCCTGTTACATCTCAGTTAAGTG 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1072027825 10:91480124-91480146 TGAAGGGTTAAGGCCAAACTGGG No data
1072027818_1072027823 -1 Left 1072027818 10:91480092-91480114 CCCTGTTACATCTCAGTTAAGTG 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1072027823 10:91480114-91480136 GTCTGAGGACTGAAGGGTTAAGG No data
1072027818_1072027822 -7 Left 1072027818 10:91480092-91480114 CCCTGTTACATCTCAGTTAAGTG 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1072027822 10:91480108-91480130 TTAAGTGTCTGAGGACTGAAGGG No data
1072027818_1072027821 -8 Left 1072027818 10:91480092-91480114 CCCTGTTACATCTCAGTTAAGTG 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1072027821 10:91480107-91480129 GTTAAGTGTCTGAGGACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072027818 Original CRISPR CACTTAACTGAGATGTAACA GGG (reversed) Intronic
902421382 1:16283205-16283227 CAAATAACTGAGAAGTAGCAAGG + Intronic
909924531 1:81423727-81423749 ATGTTAACTGAGATGTAAAAAGG + Intronic
910263789 1:85316770-85316792 AAGTTAACTGGCATGTAACAGGG + Intergenic
910939587 1:92518768-92518790 AACTTCACTGAGATGTATCATGG - Intronic
911634780 1:100222769-100222791 AACCTAACTGAGAGGTACCATGG - Intronic
916898486 1:169193405-169193427 AACTTAACTGAACTGAAACATGG + Intronic
917855129 1:179093388-179093410 CCCTTAACAGAGGTGGAACACGG - Intronic
918396024 1:184113895-184113917 CACCAAACTCAGATGCAACACGG - Intergenic
919966716 1:202534214-202534236 CACTTAAATGATATGACACAAGG - Intronic
920930446 1:210382988-210383010 CAGTTAACTCATTTGTAACACGG + Intronic
921921873 1:220678720-220678742 CACGAAACTGAGATGTCACCTGG - Intergenic
923026970 1:230212143-230212165 CACTTGCCTGAGTTCTAACAGGG + Intronic
924275209 1:242379156-242379178 CACTCAACTTAAATGTAACAGGG + Intronic
1063654333 10:7972638-7972660 CACATAAGTGAGATTTAAAATGG - Intronic
1068861561 10:61853230-61853252 AACTTAAATGAGATATAAAAGGG - Intergenic
1071509579 10:86252993-86253015 TACTTAACTAAGATGGAAAATGG + Intronic
1072027818 10:91480092-91480114 CACTTAACTGAGATGTAACAGGG - Intronic
1072957456 10:99899788-99899810 CACTTAAATGATATATATCATGG + Intronic
1077868399 11:6241313-6241335 CACCATACTGAGATCTAACAGGG - Intronic
1078900837 11:15641068-15641090 AATTAAACTGATATGTAACAAGG + Intergenic
1078926757 11:15882043-15882065 CTTTCAACTGAGAGGTAACATGG + Intergenic
1079091865 11:17486318-17486340 CACTTACCTGACAGGTACCAAGG - Intergenic
1079720343 11:23803686-23803708 AACTAACCTTAGATGTAACATGG - Intergenic
1080154506 11:29093036-29093058 CACTTAATGAAGAGGTAACAAGG + Intergenic
1083877167 11:65530462-65530484 CACTTACCTGCCATGTAAAATGG - Intronic
1088528185 11:110779106-110779128 CCCTAAACTGACATGTAAGAAGG + Intergenic
1089202173 11:116731200-116731222 CACCTAACAGACATGTACCAGGG + Intergenic
1091264314 11:134258637-134258659 CACTGCACTGAGATATAGCAGGG + Intronic
1093442035 12:19210255-19210277 CATTTTACTAAGATGTATCAGGG - Intronic
1094285612 12:28789734-28789756 CACTGAACTAAGATGGAACTGGG + Intergenic
1095679637 12:44958981-44959003 GACTTAACTGAGTTGTAAAGGGG + Intergenic
1095934535 12:47662882-47662904 TCCTTAACTGGTATGTAACATGG + Exonic
1097395650 12:59070975-59070997 CACTAAATTTAAATGTAACACGG + Intergenic
1097816006 12:64074348-64074370 CACTTAATTGAGAATCAACAGGG - Intronic
1102619444 12:114182439-114182461 CACTGAACCAAGTTGTAACATGG - Intergenic
1102710648 12:114923478-114923500 CCATTAGCTGAGATGAAACATGG - Intergenic
1104755658 12:131267794-131267816 TGCTTGACTGTGATGTAACAGGG + Intergenic
1106629886 13:31460289-31460311 CACTTTCCTGCCATGTAACATGG - Intergenic
1106679366 13:31994294-31994316 CACCTTTCAGAGATGTAACACGG - Intergenic
1111906183 13:94258907-94258929 CATCAAACAGAGATGTAACAAGG + Intronic
1112189594 13:97163390-97163412 CACCTAACTGGGATGGGACAGGG + Intergenic
1113061288 13:106324814-106324836 CACTTACCTGAAATGCATCATGG + Intergenic
1114430852 14:22659122-22659144 TACTTAGCTTAGATGTAATAAGG - Intergenic
1117567986 14:57016002-57016024 CAATTAACTTAGATGTACCATGG + Intergenic
1117596348 14:57330468-57330490 CACTTATGTGAGATATCACACGG - Intergenic
1119464939 14:74849566-74849588 AACATCACTGACATGTAACACGG - Intronic
1119935004 14:78584134-78584156 CACTAATCTGAGAGGTGACATGG - Intronic
1125095508 15:35845986-35846008 CCTTAAATTGAGATGTAACAAGG - Intergenic
1126919332 15:53503373-53503395 CTCTTCACAGAGATGGAACATGG - Intergenic
1127148555 15:56050398-56050420 CAGCCAACTGAGATGGAACACGG - Intergenic
1127757802 15:62110305-62110327 CACTTAAGTGTGATGTACCTTGG - Intergenic
1130378773 15:83354434-83354456 CACTTAACTGTAAAGTCACAAGG - Intergenic
1131775798 15:95797076-95797098 CACTTACCTGATCTGTAAAATGG + Intergenic
1132069548 15:98763682-98763704 CACTTAACCCAGTTGTAACAAGG - Intronic
1135085640 16:19472644-19472666 GAATTAACTGAGATCAAACAAGG - Intronic
1136589271 16:31207640-31207662 CACTTCGGTGAGATGTCACAGGG + Intergenic
1136985267 16:35097748-35097770 CACTTAACTGACATTTAAAGAGG + Intergenic
1140562511 16:75999704-75999726 CACTTTACTGATATGAAAAAAGG + Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1151058501 17:71061844-71061866 CATTTATCTGACATGAAACACGG + Intergenic
1155245301 18:23902615-23902637 CACTTGACCGAGAGGTCACACGG - Intronic
1156910800 18:42409097-42409119 CAGTTGACTGAGATGTACCTAGG + Intergenic
1157011917 18:43659672-43659694 CACTGAATTGAAATGTTACATGG + Intergenic
1159564135 18:70029053-70029075 CACTTTATTGAGATGAAACATGG - Intronic
1164145399 19:22509785-22509807 CACTTAGCTCAGATGGAACCTGG - Intronic
1164762053 19:30735608-30735630 CACTTAACTTAGCTGTAAAATGG + Intergenic
1168126763 19:54288230-54288252 CACTTCACTGAGATTTGACGAGG - Intergenic
1168173633 19:54607698-54607720 CACTTCACTGAGATTTGACAAGG + Intronic
926700253 2:15798718-15798740 CACTTGGCTGAGATGTCTCAGGG - Intergenic
926851158 2:17198770-17198792 CAATTAAGTGAGATGTACCTAGG - Intergenic
927152101 2:20202191-20202213 AACTTACCTCAGAAGTAACAAGG + Exonic
942307622 2:174624559-174624581 CACCCAAGTGAGATGAAACATGG - Intronic
943149585 2:184095126-184095148 TACTTAACTGAGATGAAAGACGG - Intergenic
945509183 2:210679601-210679623 CAATTGACTGTGAGGTAACAAGG - Intergenic
946536177 2:220631516-220631538 CACTCACCTGAGATTGAACATGG + Intergenic
948156951 2:235791267-235791289 CACTTTACTGTGATTTAAAATGG + Intronic
1169806177 20:9561594-9561616 CACTGAAATGAGATGTTACGTGG - Intronic
1178404494 21:32313073-32313095 CACTTGACTGAGCTGGAACTCGG + Exonic
1181450706 22:23018199-23018221 CACATAACTCAGAGGTATCAGGG + Intergenic
955353842 3:58214294-58214316 CGCTTAACTGTGTTGAAACAGGG + Intronic
957265253 3:77955421-77955443 TAGTTAATTGAGATGTAACGTGG + Intergenic
957605352 3:82391674-82391696 CAATATACTGACATGTAACATGG + Intergenic
958890657 3:99778950-99778972 CACTTGAGTGAGCTGTTACATGG + Intronic
959007925 3:101041418-101041440 TACTTAATTGACATGTACCATGG + Intergenic
962189689 3:133297516-133297538 CACATAACTGAGATTTACCTGGG + Intronic
962742294 3:138370544-138370566 CACTTAACTGAGCTCTTCCATGG - Intronic
968322675 3:197784880-197784902 CACTTTACTAAGGTGTAAAAAGG - Exonic
970286340 4:14520689-14520711 CACAGAACTGAGATGCAAAAAGG - Intergenic
970752386 4:19379569-19379591 GAATTAACGGAGAAGTAACATGG + Intergenic
971389277 4:26170625-26170647 CAGTTAAGTGAGATGTAAGTTGG + Intronic
976378905 4:84377201-84377223 TACTTAAATGAGAAGTGACAGGG - Intergenic
976869618 4:89775267-89775289 CACCTAACAGAAATGTAACTTGG - Intronic
984144611 4:176045212-176045234 CACTTAAAAGAGAGGAAACAGGG + Intergenic
986416299 5:7531335-7531357 CACAAAACTTAGATGTAGCATGG - Intronic
986910945 5:12556055-12556077 CACATAACTGAAAATTAACATGG - Intergenic
989255296 5:39359736-39359758 CACTTGGCTGAGGTGCAACAAGG + Intronic
990673525 5:58159197-58159219 CACATAGCTGAGAAGTAGCAGGG - Intergenic
993566479 5:89482432-89482454 CACATAACTGATATTTAAAATGG - Intergenic
995653735 5:114401455-114401477 CTGTTAACTGAGAAATAACAAGG + Intronic
996938474 5:128974783-128974805 CACTGAACTTAGTTGTAAAATGG + Intronic
1000595543 5:163211318-163211340 CACTTATCCTAGAGGTAACAGGG + Intergenic
1007082184 6:39115374-39115396 CCCTTAAGTGAGATGCAGCAAGG - Intergenic
1009325182 6:62339803-62339825 CATTTAACTGTGGTGTAATATGG - Intergenic
1009840837 6:69072735-69072757 CTCTTCACTGTGATGTTACAAGG + Intronic
1009860960 6:69331544-69331566 CCCTCAACTAAGCTGTAACAGGG + Intronic
1012272260 6:97228220-97228242 CACTTTTCTGAGAGGTAGCAGGG + Intronic
1014090324 6:117397417-117397439 GACTTAAATGAGTTGAAACATGG + Intronic
1018673707 6:166200903-166200925 CACTTAAACGAGATGTAACTGGG + Intergenic
1023302744 7:38791505-38791527 CACTTTACTGAAGTGTGACAGGG + Intronic
1024561752 7:50650452-50650474 CACTTAGATGAGATGTGTCAAGG + Intronic
1038331998 8:26616483-26616505 CATTTATCTGAGATGAAAAAGGG + Intronic
1040032376 8:42837032-42837054 CACTTGACTGAGTTGGGACAAGG - Exonic
1045398142 8:101782800-101782822 CACCTAACAGAGATGTAAAGAGG + Intronic
1046114552 8:109769200-109769222 CCCTGAACTGGGATGAAACATGG - Intergenic
1046577078 8:116043630-116043652 CACTTAAGTGATACCTAACAGGG + Intergenic
1047359033 8:124150970-124150992 AACTTAACTGCTATGTAACTTGG - Intergenic
1049963739 9:760205-760227 CACATGACTTAAATGTAACAAGG - Intergenic
1050746934 9:8887064-8887086 CAGTTAACTCACATGTAAAATGG - Intronic
1051800193 9:20923948-20923970 CACTTAACTGTGATGGAGAAAGG - Intronic
1052457345 9:28717263-28717285 CACTTAACTGAGCTCAAACTAGG + Intergenic
1053052123 9:34970873-34970895 CACTTCACAGGGATGTTACAAGG - Intronic
1058601440 9:106674963-106674985 TACTTAGCTAAGAAGTAACAGGG - Intergenic
1061228011 9:129292019-129292041 CAGTTAACTTAGAGTTAACATGG + Intergenic
1186522923 X:10221671-10221693 CATTTAACTAATGTGTAACATGG - Intronic
1188396529 X:29691208-29691230 CACTTAAATGAGCTGGAAAATGG - Intronic
1189996656 X:46645788-46645810 CACTTCACTGCCATGAAACAAGG + Intronic
1195519911 X:105819218-105819240 AACAGAACTGAGATGTTACATGG - Intergenic
1195578964 X:106480335-106480357 CACTTCACTCAGATGGACCATGG + Intergenic
1198719487 X:139600527-139600549 CACTTGTTTGAGATATAACATGG - Intronic
1198731821 X:139739189-139739211 CAGTTAACTGAGCCATAACAGGG + Intronic
1199678019 X:150204302-150204324 CACTCAACTGGCATGGAACAAGG + Intergenic
1201892229 Y:18955257-18955279 CACTTAACTCAGAGCTAGCATGG - Intergenic
1201968734 Y:19768250-19768272 CACTTTTCTCAGATGTAAAATGG + Intergenic