ID: 1072031512

View in Genome Browser
Species Human (GRCh38)
Location 10:91526472-91526494
Sequence ATGTTCCCGTTAAAGATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072031507_1072031512 -4 Left 1072031507 10:91526453-91526475 CCCTGTGGCAAGCCCCAGCATGT No data
Right 1072031512 10:91526472-91526494 ATGTTCCCGTTAAAGATCAAAGG No data
1072031508_1072031512 -5 Left 1072031508 10:91526454-91526476 CCTGTGGCAAGCCCCAGCATGTT No data
Right 1072031512 10:91526472-91526494 ATGTTCCCGTTAAAGATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072031512 Original CRISPR ATGTTCCCGTTAAAGATCAA AGG Intergenic
No off target data available for this crispr