ID: 1072031925

View in Genome Browser
Species Human (GRCh38)
Location 10:91529589-91529611
Sequence TTTAGGTAGAAGACCTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072031925_1072031932 2 Left 1072031925 10:91529589-91529611 CCCACCCAGGTCTTCTACCTAAA No data
Right 1072031932 10:91529614-91529636 CCTATTTGTGATGGCAGTGTTGG No data
1072031925_1072031934 11 Left 1072031925 10:91529589-91529611 CCCACCCAGGTCTTCTACCTAAA No data
Right 1072031934 10:91529623-91529645 GATGGCAGTGTTGGAGTGTTGGG No data
1072031925_1072031935 14 Left 1072031925 10:91529589-91529611 CCCACCCAGGTCTTCTACCTAAA No data
Right 1072031935 10:91529626-91529648 GGCAGTGTTGGAGTGTTGGGAGG No data
1072031925_1072031933 10 Left 1072031925 10:91529589-91529611 CCCACCCAGGTCTTCTACCTAAA No data
Right 1072031933 10:91529622-91529644 TGATGGCAGTGTTGGAGTGTTGG No data
1072031925_1072031936 27 Left 1072031925 10:91529589-91529611 CCCACCCAGGTCTTCTACCTAAA No data
Right 1072031936 10:91529639-91529661 TGTTGGGAGGATACAAGACCAGG No data
1072031925_1072031929 -7 Left 1072031925 10:91529589-91529611 CCCACCCAGGTCTTCTACCTAAA No data
Right 1072031929 10:91529605-91529627 ACCTAAAATCCTATTTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072031925 Original CRISPR TTTAGGTAGAAGACCTGGGT GGG (reversed) Intergenic
No off target data available for this crispr