ID: 1072033516

View in Genome Browser
Species Human (GRCh38)
Location 10:91543217-91543239
Sequence ATTGGAAGCAGGGGTGGTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072033516_1072033531 30 Left 1072033516 10:91543217-91543239 CCCATACCACCCCTGCTTCCAAT No data
Right 1072033531 10:91543270-91543292 AGTAGTGGTTTGAGAAATGAAGG No data
1072033516_1072033528 15 Left 1072033516 10:91543217-91543239 CCCATACCACCCCTGCTTCCAAT No data
Right 1072033528 10:91543255-91543277 TGAAAGCCCTGTACAAGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072033516 Original CRISPR ATTGGAAGCAGGGGTGGTAT GGG (reversed) Intergenic
No off target data available for this crispr