ID: 1072033521

View in Genome Browser
Species Human (GRCh38)
Location 10:91543228-91543250
Sequence ATTTAGGGGAAATTGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072033521_1072033532 20 Left 1072033521 10:91543228-91543250 CCTGCTTCCAATTTCCCCTAAAT No data
Right 1072033532 10:91543271-91543293 GTAGTGGTTTGAGAAATGAAGGG No data
1072033521_1072033531 19 Left 1072033521 10:91543228-91543250 CCTGCTTCCAATTTCCCCTAAAT No data
Right 1072033531 10:91543270-91543292 AGTAGTGGTTTGAGAAATGAAGG No data
1072033521_1072033528 4 Left 1072033521 10:91543228-91543250 CCTGCTTCCAATTTCCCCTAAAT No data
Right 1072033528 10:91543255-91543277 TGAAAGCCCTGTACAAGTAGTGG No data
1072033521_1072033533 27 Left 1072033521 10:91543228-91543250 CCTGCTTCCAATTTCCCCTAAAT No data
Right 1072033533 10:91543278-91543300 TTTGAGAAATGAAGGGATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072033521 Original CRISPR ATTTAGGGGAAATTGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr