ID: 1072033522

View in Genome Browser
Species Human (GRCh38)
Location 10:91543235-91543257
Sequence TCAGGGCATTTAGGGGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072033522_1072033531 12 Left 1072033522 10:91543235-91543257 CCAATTTCCCCTAAATGCCCTGA No data
Right 1072033531 10:91543270-91543292 AGTAGTGGTTTGAGAAATGAAGG No data
1072033522_1072033534 25 Left 1072033522 10:91543235-91543257 CCAATTTCCCCTAAATGCCCTGA No data
Right 1072033534 10:91543283-91543305 GAAATGAAGGGATATAGGACAGG No data
1072033522_1072033528 -3 Left 1072033522 10:91543235-91543257 CCAATTTCCCCTAAATGCCCTGA No data
Right 1072033528 10:91543255-91543277 TGAAAGCCCTGTACAAGTAGTGG No data
1072033522_1072033535 29 Left 1072033522 10:91543235-91543257 CCAATTTCCCCTAAATGCCCTGA No data
Right 1072033535 10:91543287-91543309 TGAAGGGATATAGGACAGGAAGG No data
1072033522_1072033533 20 Left 1072033522 10:91543235-91543257 CCAATTTCCCCTAAATGCCCTGA No data
Right 1072033533 10:91543278-91543300 TTTGAGAAATGAAGGGATATAGG No data
1072033522_1072033532 13 Left 1072033522 10:91543235-91543257 CCAATTTCCCCTAAATGCCCTGA No data
Right 1072033532 10:91543271-91543293 GTAGTGGTTTGAGAAATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072033522 Original CRISPR TCAGGGCATTTAGGGGAAAT TGG (reversed) Intergenic
No off target data available for this crispr