ID: 1072033523

View in Genome Browser
Species Human (GRCh38)
Location 10:91543242-91543264
Sequence AGGGCTTTCAGGGCATTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072033523_1072033534 18 Left 1072033523 10:91543242-91543264 CCCCTAAATGCCCTGAAAGCCCT No data
Right 1072033534 10:91543283-91543305 GAAATGAAGGGATATAGGACAGG No data
1072033523_1072033537 27 Left 1072033523 10:91543242-91543264 CCCCTAAATGCCCTGAAAGCCCT No data
Right 1072033537 10:91543292-91543314 GGATATAGGACAGGAAGGAAGGG No data
1072033523_1072033531 5 Left 1072033523 10:91543242-91543264 CCCCTAAATGCCCTGAAAGCCCT No data
Right 1072033531 10:91543270-91543292 AGTAGTGGTTTGAGAAATGAAGG No data
1072033523_1072033533 13 Left 1072033523 10:91543242-91543264 CCCCTAAATGCCCTGAAAGCCCT No data
Right 1072033533 10:91543278-91543300 TTTGAGAAATGAAGGGATATAGG No data
1072033523_1072033535 22 Left 1072033523 10:91543242-91543264 CCCCTAAATGCCCTGAAAGCCCT No data
Right 1072033535 10:91543287-91543309 TGAAGGGATATAGGACAGGAAGG No data
1072033523_1072033538 30 Left 1072033523 10:91543242-91543264 CCCCTAAATGCCCTGAAAGCCCT No data
Right 1072033538 10:91543295-91543317 TATAGGACAGGAAGGAAGGGAGG No data
1072033523_1072033532 6 Left 1072033523 10:91543242-91543264 CCCCTAAATGCCCTGAAAGCCCT No data
Right 1072033532 10:91543271-91543293 GTAGTGGTTTGAGAAATGAAGGG No data
1072033523_1072033528 -10 Left 1072033523 10:91543242-91543264 CCCCTAAATGCCCTGAAAGCCCT No data
Right 1072033528 10:91543255-91543277 TGAAAGCCCTGTACAAGTAGTGG No data
1072033523_1072033536 26 Left 1072033523 10:91543242-91543264 CCCCTAAATGCCCTGAAAGCCCT No data
Right 1072033536 10:91543291-91543313 GGGATATAGGACAGGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072033523 Original CRISPR AGGGCTTTCAGGGCATTTAG GGG (reversed) Intergenic
No off target data available for this crispr