ID: 1072033528

View in Genome Browser
Species Human (GRCh38)
Location 10:91543255-91543277
Sequence TGAAAGCCCTGTACAAGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072033518_1072033528 9 Left 1072033518 10:91543223-91543245 CCACCCCTGCTTCCAATTTCCCC No data
Right 1072033528 10:91543255-91543277 TGAAAGCCCTGTACAAGTAGTGG No data
1072033521_1072033528 4 Left 1072033521 10:91543228-91543250 CCTGCTTCCAATTTCCCCTAAAT No data
Right 1072033528 10:91543255-91543277 TGAAAGCCCTGTACAAGTAGTGG No data
1072033523_1072033528 -10 Left 1072033523 10:91543242-91543264 CCCCTAAATGCCCTGAAAGCCCT No data
Right 1072033528 10:91543255-91543277 TGAAAGCCCTGTACAAGTAGTGG No data
1072033516_1072033528 15 Left 1072033516 10:91543217-91543239 CCCATACCACCCCTGCTTCCAAT No data
Right 1072033528 10:91543255-91543277 TGAAAGCCCTGTACAAGTAGTGG No data
1072033522_1072033528 -3 Left 1072033522 10:91543235-91543257 CCAATTTCCCCTAAATGCCCTGA No data
Right 1072033528 10:91543255-91543277 TGAAAGCCCTGTACAAGTAGTGG No data
1072033519_1072033528 6 Left 1072033519 10:91543226-91543248 CCCCTGCTTCCAATTTCCCCTAA No data
Right 1072033528 10:91543255-91543277 TGAAAGCCCTGTACAAGTAGTGG No data
1072033520_1072033528 5 Left 1072033520 10:91543227-91543249 CCCTGCTTCCAATTTCCCCTAAA No data
Right 1072033528 10:91543255-91543277 TGAAAGCCCTGTACAAGTAGTGG No data
1072033517_1072033528 14 Left 1072033517 10:91543218-91543240 CCATACCACCCCTGCTTCCAATT No data
Right 1072033528 10:91543255-91543277 TGAAAGCCCTGTACAAGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072033528 Original CRISPR TGAAAGCCCTGTACAAGTAG TGG Intergenic
No off target data available for this crispr