ID: 1072033532

View in Genome Browser
Species Human (GRCh38)
Location 10:91543271-91543293
Sequence GTAGTGGTTTGAGAAATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072033527_1072033532 -5 Left 1072033527 10:91543253-91543275 CCTGAAAGCCCTGTACAAGTAGT No data
Right 1072033532 10:91543271-91543293 GTAGTGGTTTGAGAAATGAAGGG No data
1072033523_1072033532 6 Left 1072033523 10:91543242-91543264 CCCCTAAATGCCCTGAAAGCCCT No data
Right 1072033532 10:91543271-91543293 GTAGTGGTTTGAGAAATGAAGGG No data
1072033522_1072033532 13 Left 1072033522 10:91543235-91543257 CCAATTTCCCCTAAATGCCCTGA No data
Right 1072033532 10:91543271-91543293 GTAGTGGTTTGAGAAATGAAGGG No data
1072033521_1072033532 20 Left 1072033521 10:91543228-91543250 CCTGCTTCCAATTTCCCCTAAAT No data
Right 1072033532 10:91543271-91543293 GTAGTGGTTTGAGAAATGAAGGG No data
1072033517_1072033532 30 Left 1072033517 10:91543218-91543240 CCATACCACCCCTGCTTCCAATT No data
Right 1072033532 10:91543271-91543293 GTAGTGGTTTGAGAAATGAAGGG No data
1072033524_1072033532 5 Left 1072033524 10:91543243-91543265 CCCTAAATGCCCTGAAAGCCCTG No data
Right 1072033532 10:91543271-91543293 GTAGTGGTTTGAGAAATGAAGGG No data
1072033525_1072033532 4 Left 1072033525 10:91543244-91543266 CCTAAATGCCCTGAAAGCCCTGT No data
Right 1072033532 10:91543271-91543293 GTAGTGGTTTGAGAAATGAAGGG No data
1072033520_1072033532 21 Left 1072033520 10:91543227-91543249 CCCTGCTTCCAATTTCCCCTAAA No data
Right 1072033532 10:91543271-91543293 GTAGTGGTTTGAGAAATGAAGGG No data
1072033518_1072033532 25 Left 1072033518 10:91543223-91543245 CCACCCCTGCTTCCAATTTCCCC No data
Right 1072033532 10:91543271-91543293 GTAGTGGTTTGAGAAATGAAGGG No data
1072033526_1072033532 -4 Left 1072033526 10:91543252-91543274 CCCTGAAAGCCCTGTACAAGTAG No data
Right 1072033532 10:91543271-91543293 GTAGTGGTTTGAGAAATGAAGGG No data
1072033519_1072033532 22 Left 1072033519 10:91543226-91543248 CCCCTGCTTCCAATTTCCCCTAA No data
Right 1072033532 10:91543271-91543293 GTAGTGGTTTGAGAAATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072033532 Original CRISPR GTAGTGGTTTGAGAAATGAA GGG Intergenic
No off target data available for this crispr