ID: 1072042919

View in Genome Browser
Species Human (GRCh38)
Location 10:91626582-91626604
Sequence GTCCACTCATTGTCAAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072042912_1072042919 16 Left 1072042912 10:91626543-91626565 CCACTGGCTTAGAGGGACCATCC No data
Right 1072042919 10:91626582-91626604 GTCCACTCATTGTCAAAAAGAGG No data
1072042916_1072042919 -1 Left 1072042916 10:91626560-91626582 CCATCCAAATCCAGGAATGGGTG No data
Right 1072042919 10:91626582-91626604 GTCCACTCATTGTCAAAAAGAGG No data
1072042917_1072042919 -5 Left 1072042917 10:91626564-91626586 CCAAATCCAGGAATGGGTGTCCA No data
Right 1072042919 10:91626582-91626604 GTCCACTCATTGTCAAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072042919 Original CRISPR GTCCACTCATTGTCAAAAAG AGG Intergenic
No off target data available for this crispr