ID: 1072044059

View in Genome Browser
Species Human (GRCh38)
Location 10:91637252-91637274
Sequence AGACAATGGTCTAGGTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072044054_1072044059 4 Left 1072044054 10:91637225-91637247 CCATTTGTAAAATAGTCCAGTAA No data
Right 1072044059 10:91637252-91637274 AGACAATGGTCTAGGTGTGGTGG No data
1072044053_1072044059 5 Left 1072044053 10:91637224-91637246 CCCATTTGTAAAATAGTCCAGTA No data
Right 1072044059 10:91637252-91637274 AGACAATGGTCTAGGTGTGGTGG No data
1072044051_1072044059 13 Left 1072044051 10:91637216-91637238 CCTCAAACCCCATTTGTAAAATA No data
Right 1072044059 10:91637252-91637274 AGACAATGGTCTAGGTGTGGTGG No data
1072044052_1072044059 6 Left 1072044052 10:91637223-91637245 CCCCATTTGTAAAATAGTCCAGT No data
Right 1072044059 10:91637252-91637274 AGACAATGGTCTAGGTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072044059 Original CRISPR AGACAATGGTCTAGGTGTGG TGG Intergenic
No off target data available for this crispr