ID: 1072048192

View in Genome Browser
Species Human (GRCh38)
Location 10:91678199-91678221
Sequence AGAGCACGATCTAATGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072048186_1072048192 21 Left 1072048186 10:91678155-91678177 CCCAAGGAGACAGCCTACACAGT No data
Right 1072048192 10:91678199-91678221 AGAGCACGATCTAATGTTGAGGG No data
1072048188_1072048192 8 Left 1072048188 10:91678168-91678190 CCTACACAGTGTGCAGAGTGCTG No data
Right 1072048192 10:91678199-91678221 AGAGCACGATCTAATGTTGAGGG No data
1072048187_1072048192 20 Left 1072048187 10:91678156-91678178 CCAAGGAGACAGCCTACACAGTG No data
Right 1072048192 10:91678199-91678221 AGAGCACGATCTAATGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072048192 Original CRISPR AGAGCACGATCTAATGTTGA GGG Intergenic