ID: 1072048327

View in Genome Browser
Species Human (GRCh38)
Location 10:91679320-91679342
Sequence TCCTTGGAAGAACCATCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072048327_1072048331 17 Left 1072048327 10:91679320-91679342 CCACCAGATGGTTCTTCCAAGGA No data
Right 1072048331 10:91679360-91679382 AATATTATCTGCAGACTCCAGGG No data
1072048327_1072048336 30 Left 1072048327 10:91679320-91679342 CCACCAGATGGTTCTTCCAAGGA No data
Right 1072048336 10:91679373-91679395 GACTCCAGGGGGCCTTCTAGGGG No data
1072048327_1072048335 29 Left 1072048327 10:91679320-91679342 CCACCAGATGGTTCTTCCAAGGA No data
Right 1072048335 10:91679372-91679394 AGACTCCAGGGGGCCTTCTAGGG No data
1072048327_1072048334 28 Left 1072048327 10:91679320-91679342 CCACCAGATGGTTCTTCCAAGGA No data
Right 1072048334 10:91679371-91679393 CAGACTCCAGGGGGCCTTCTAGG No data
1072048327_1072048330 16 Left 1072048327 10:91679320-91679342 CCACCAGATGGTTCTTCCAAGGA No data
Right 1072048330 10:91679359-91679381 GAATATTATCTGCAGACTCCAGG No data
1072048327_1072048333 19 Left 1072048327 10:91679320-91679342 CCACCAGATGGTTCTTCCAAGGA No data
Right 1072048333 10:91679362-91679384 TATTATCTGCAGACTCCAGGGGG No data
1072048327_1072048332 18 Left 1072048327 10:91679320-91679342 CCACCAGATGGTTCTTCCAAGGA No data
Right 1072048332 10:91679361-91679383 ATATTATCTGCAGACTCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072048327 Original CRISPR TCCTTGGAAGAACCATCTGG TGG (reversed) Intergenic
No off target data available for this crispr