ID: 1072048328

View in Genome Browser
Species Human (GRCh38)
Location 10:91679323-91679345
Sequence ATTTCCTTGGAAGAACCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072048328_1072048333 16 Left 1072048328 10:91679323-91679345 CCAGATGGTTCTTCCAAGGAAAT No data
Right 1072048333 10:91679362-91679384 TATTATCTGCAGACTCCAGGGGG No data
1072048328_1072048335 26 Left 1072048328 10:91679323-91679345 CCAGATGGTTCTTCCAAGGAAAT No data
Right 1072048335 10:91679372-91679394 AGACTCCAGGGGGCCTTCTAGGG No data
1072048328_1072048336 27 Left 1072048328 10:91679323-91679345 CCAGATGGTTCTTCCAAGGAAAT No data
Right 1072048336 10:91679373-91679395 GACTCCAGGGGGCCTTCTAGGGG No data
1072048328_1072048331 14 Left 1072048328 10:91679323-91679345 CCAGATGGTTCTTCCAAGGAAAT No data
Right 1072048331 10:91679360-91679382 AATATTATCTGCAGACTCCAGGG No data
1072048328_1072048332 15 Left 1072048328 10:91679323-91679345 CCAGATGGTTCTTCCAAGGAAAT No data
Right 1072048332 10:91679361-91679383 ATATTATCTGCAGACTCCAGGGG No data
1072048328_1072048334 25 Left 1072048328 10:91679323-91679345 CCAGATGGTTCTTCCAAGGAAAT No data
Right 1072048334 10:91679371-91679393 CAGACTCCAGGGGGCCTTCTAGG No data
1072048328_1072048330 13 Left 1072048328 10:91679323-91679345 CCAGATGGTTCTTCCAAGGAAAT No data
Right 1072048330 10:91679359-91679381 GAATATTATCTGCAGACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072048328 Original CRISPR ATTTCCTTGGAAGAACCATC TGG (reversed) Intergenic
No off target data available for this crispr