ID: 1072048333

View in Genome Browser
Species Human (GRCh38)
Location 10:91679362-91679384
Sequence TATTATCTGCAGACTCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072048328_1072048333 16 Left 1072048328 10:91679323-91679345 CCAGATGGTTCTTCCAAGGAAAT No data
Right 1072048333 10:91679362-91679384 TATTATCTGCAGACTCCAGGGGG No data
1072048327_1072048333 19 Left 1072048327 10:91679320-91679342 CCACCAGATGGTTCTTCCAAGGA No data
Right 1072048333 10:91679362-91679384 TATTATCTGCAGACTCCAGGGGG No data
1072048329_1072048333 3 Left 1072048329 10:91679336-91679358 CCAAGGAAATTCTTTTTATATTT No data
Right 1072048333 10:91679362-91679384 TATTATCTGCAGACTCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072048333 Original CRISPR TATTATCTGCAGACTCCAGG GGG Intergenic
No off target data available for this crispr