ID: 1072051220

View in Genome Browser
Species Human (GRCh38)
Location 10:91705474-91705496
Sequence CTGTCAACCCAGATGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072051220_1072051224 13 Left 1072051220 10:91705474-91705496 CCCTACTCCATCTGGGTTGACAG No data
Right 1072051224 10:91705510-91705532 AGTGTCCAGCCTCTTTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072051220 Original CRISPR CTGTCAACCCAGATGGAGTA GGG (reversed) Intergenic
No off target data available for this crispr