ID: 1072051223

View in Genome Browser
Species Human (GRCh38)
Location 10:91705500-91705522
Sequence GAGGCTGGACACTTTGACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072051223_1072051228 12 Left 1072051223 10:91705500-91705522 CCAAAGTCAAAGTGTCCAGCCTC No data
Right 1072051228 10:91705535-91705557 CCATTGCTAGAGTGTGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072051223 Original CRISPR GAGGCTGGACACTTTGACTT TGG (reversed) Intergenic
No off target data available for this crispr