ID: 1072056050

View in Genome Browser
Species Human (GRCh38)
Location 10:91756957-91756979
Sequence ATTTTTCCACAGATGGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072056036_1072056050 20 Left 1072056036 10:91756914-91756936 CCCCCAACCTTTTTGGCACCAGG 0: 48
1: 92
2: 68
3: 93
4: 194
Right 1072056050 10:91756957-91756979 ATTTTTCCACAGATGGGGATGGG No data
1072056038_1072056050 19 Left 1072056038 10:91756915-91756937 CCCCAACCTTTTTGGCACCAGGG 0: 949
1: 1567
2: 1323
3: 855
4: 618
Right 1072056050 10:91756957-91756979 ATTTTTCCACAGATGGGGATGGG No data
1072056043_1072056050 13 Left 1072056043 10:91756921-91756943 CCTTTTTGGCACCAGGGGTCAGT No data
Right 1072056050 10:91756957-91756979 ATTTTTCCACAGATGGGGATGGG No data
1072056042_1072056050 17 Left 1072056042 10:91756917-91756939 CCAACCTTTTTGGCACCAGGGGT 0: 3
1: 114
2: 1144
3: 1812
4: 1468
Right 1072056050 10:91756957-91756979 ATTTTTCCACAGATGGGGATGGG No data
1072056040_1072056050 18 Left 1072056040 10:91756916-91756938 CCCAACCTTTTTGGCACCAGGGG 0: 36
1: 1039
2: 1659
3: 1384
4: 941
Right 1072056050 10:91756957-91756979 ATTTTTCCACAGATGGGGATGGG No data
1072056045_1072056050 2 Left 1072056045 10:91756932-91756954 CCAGGGGTCAGTTTCACGGAAGA No data
Right 1072056050 10:91756957-91756979 ATTTTTCCACAGATGGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072056050 Original CRISPR ATTTTTCCACAGATGGGGAT GGG Intergenic
No off target data available for this crispr