ID: 1072059740

View in Genome Browser
Species Human (GRCh38)
Location 10:91798476-91798498
Sequence CTCCGCCGCCGCGGGGCAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 219}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072059735_1072059740 -1 Left 1072059735 10:91798454-91798476 CCGGACGGCGGATTCGCGCTGCC 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1072059740 10:91798476-91798498 CTCCGCCGCCGCGGGGCAGCCGG 0: 1
1: 0
2: 3
3: 23
4: 219
1072059728_1072059740 22 Left 1072059728 10:91798431-91798453 CCGCCGCCGCGTCGTTTCAGGAC 0: 1
1: 0
2: 0
3: 1
4: 16
Right 1072059740 10:91798476-91798498 CTCCGCCGCCGCGGGGCAGCCGG 0: 1
1: 0
2: 3
3: 23
4: 219
1072059726_1072059740 29 Left 1072059726 10:91798424-91798446 CCAGCTTCCGCCGCCGCGTCGTT 0: 1
1: 0
2: 1
3: 4
4: 62
Right 1072059740 10:91798476-91798498 CTCCGCCGCCGCGGGGCAGCCGG 0: 1
1: 0
2: 3
3: 23
4: 219
1072059734_1072059740 0 Left 1072059734 10:91798453-91798475 CCCGGACGGCGGATTCGCGCTGC 0: 1
1: 0
2: 0
3: 6
4: 22
Right 1072059740 10:91798476-91798498 CTCCGCCGCCGCGGGGCAGCCGG 0: 1
1: 0
2: 3
3: 23
4: 219
1072059731_1072059740 16 Left 1072059731 10:91798437-91798459 CCGCGTCGTTTCAGGACCCGGAC 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1072059740 10:91798476-91798498 CTCCGCCGCCGCGGGGCAGCCGG 0: 1
1: 0
2: 3
3: 23
4: 219
1072059729_1072059740 19 Left 1072059729 10:91798434-91798456 CCGCCGCGTCGTTTCAGGACCCG 0: 1
1: 0
2: 1
3: 1
4: 19
Right 1072059740 10:91798476-91798498 CTCCGCCGCCGCGGGGCAGCCGG 0: 1
1: 0
2: 3
3: 23
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072059740 Original CRISPR CTCCGCCGCCGCGGGGCAGC CGG Exonic
900226635 1:1536191-1536213 CTCCGCGGCCCCGGGGCGGGCGG - Intronic
901797940 1:11691492-11691514 CGCCGCCGCCGCGAGGGCGCGGG - Exonic
902691240 1:18111007-18111029 CTCCGCAGCCGCGTGTCAGCAGG + Intronic
902808925 1:18877379-18877401 CACCCCCGCCGCGGCCCAGCGGG - Intronic
903750175 1:25616684-25616706 CGCCGCCGCCGCGCCGCAGCCGG - Intergenic
904050167 1:27634157-27634179 CTGGGCCGCCGCGGGGCTCCGGG - Intronic
904769017 1:32870761-32870783 CTGCGCCGCCCCGGGCCTGCCGG - Exonic
905580901 1:39082031-39082053 CTCCTCCGCCGTGGGGAAACGGG + Intronic
905867135 1:41382459-41382481 TGCCGCCGCCGCCGGGCCGCTGG + Exonic
907429932 1:54405905-54405927 CCGCGCCGCCGCCGGGCTGCGGG - Intronic
907516642 1:54997209-54997231 CTCCGCAGCCGCGGTCCTGCAGG - Intergenic
908131839 1:61082370-61082392 CGCCGCCGCCGCGGGGGGGAGGG - Intronic
908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG + Intergenic
908544137 1:65147958-65147980 CTCCGCCGAGCCGGGGAAGCTGG - Exonic
910892206 1:92029960-92029982 CTCCCCCGGCCCGGGGCGGCCGG - Exonic
912514841 1:110211022-110211044 TGCCGCCGCTGCGGGGAAGCCGG + Intergenic
917869638 1:179229746-179229768 CACCTCCGCCGCGGGGAAGGAGG + Intergenic
919640305 1:200039539-200039561 CTCCGCCTCCTCGGGGCTGCCGG - Intronic
921909083 1:220528292-220528314 CGCCGCCGCCGCTGGGCCCCGGG + Intronic
924502885 1:244653255-244653277 CTCCGTCTCCGCGGGGCCGGAGG - Exonic
1062898100 10:1120364-1120386 CGCCGCCTCCGAGGGGCACCCGG + Intronic
1063504013 10:6580170-6580192 CGCCGCCGCCGGGAGGGAGCGGG - Intronic
1066126322 10:32346577-32346599 CCCGGCCGCCGCGGCCCAGCGGG - Intronic
1068560958 10:58513453-58513475 CTCCGGCTCCGCGGGGGAGCGGG - Intronic
1071695380 10:87863911-87863933 CGCCGCCGCCGCGCCTCAGCCGG - Exonic
1072059740 10:91798476-91798498 CTCCGCCGCCGCGGGGCAGCCGG + Exonic
1073099599 10:100999783-100999805 CTCCGCCTCCGCGGCGCCCCCGG - Exonic
1073325572 10:102642670-102642692 CGCCGCCGCCGCGAGGAAGGCGG - Intergenic
1073531066 10:104232312-104232334 TTCCGCCGCCGCGGGGCTGCGGG + Exonic
1075630110 10:123995584-123995606 CCCGGCCGCGGAGGGGCAGCTGG - Intergenic
1077386194 11:2270585-2270607 CTCCGCAGGCGCGGCGCAGGCGG + Exonic
1079126237 11:17720328-17720350 CGCCGCGGCCCGGGGGCAGCGGG - Exonic
1080012436 11:27472368-27472390 CCCCGCCGCCCCCGGGCAGCCGG + Exonic
1081528429 11:43942620-43942642 CCTGGCCGCCGCGGGGCAGACGG + Exonic
1082059563 11:47848587-47848609 CTCAGCGGCCGCAGGGCAGGGGG + Intergenic
1083272872 11:61580882-61580904 CGCCGCCGCCGCTGGGCATGGGG + Intronic
1083571364 11:63763730-63763752 CTCCGCCCCCGCCCCGCAGCCGG - Exonic
1083596257 11:63919425-63919447 CCCTGCCGCCCCGGGGCTGCGGG + Intergenic
1083596258 11:63919426-63919448 CCCCGCAGCCCCGGGGCGGCAGG - Intergenic
1083662544 11:64258462-64258484 CGCCGCCCCAGCGGGGCAGCTGG + Exonic
1084758120 11:71251917-71251939 CTCCGCCCCCGCGCGCCACCTGG + Intronic
1085485609 11:76860784-76860806 CACCGGCGCCGCTGGGCCGCGGG - Intergenic
1090012967 11:123061802-123061824 CTCCCCCGCCACGCGGCCGCCGG + Intronic
1091259786 11:134224971-134224993 CGCCGCTGCCGCCGGGCAGTGGG - Exonic
1091689027 12:2583265-2583287 CGCCGCGGCCCCAGGGCAGCCGG - Intronic
1092143561 12:6200190-6200212 GTCGGGCTCCGCGGGGCAGCTGG + Intronic
1095476178 12:42589502-42589524 CGGCGCCGCTGCGGGGCTGCTGG + Exonic
1095956259 12:47808149-47808171 CTCCGCCACCTCAGGGCAGCTGG + Intronic
1096981240 12:55729076-55729098 CTCCCCCGCCGAGTGGCCGCCGG + Intronic
1096983734 12:55743390-55743412 CGCCGCCGCCGCGGGGCCCTCGG - Exonic
1097007155 12:55927729-55927751 CTCCGTAGCCGCAGGGCTGCCGG + Exonic
1097123225 12:56752356-56752378 CTGCGCAGTCGCGGGGCCGCCGG - Intronic
1097664918 12:62467218-62467240 CTTCACCGCCTCGGGGCTGCTGG - Exonic
1098426086 12:70366615-70366637 CGCCGCCGCCGCGCGACAGCAGG - Exonic
1100315535 12:93441650-93441672 TCCGGCCGCGGCGGGGCAGCCGG - Intronic
1103942037 12:124506429-124506451 CTTCGCCGTGGCGGGGGAGCAGG - Intronic
1104841455 12:131828035-131828057 AGCCGCCGCCGCAGCGCAGCAGG - Intergenic
1107898498 13:44989326-44989348 CTGCCCCGCCGCGGGACAGCTGG - Exonic
1108220977 13:48233161-48233183 CTCCGCCCTCGCGCGGGAGCTGG + Exonic
1111950749 13:94707395-94707417 CTCGGCCTCCGCTGGGCCGCGGG + Intergenic
1112291023 13:98143749-98143771 CTCCGCCGACGTCGGGCTGCGGG + Intronic
1113201225 13:107868339-107868361 CTCCGCAGCCGCGGGCGAGCTGG + Intergenic
1114069879 14:19098119-19098141 CTCCACCCCCGCGTGGCAGCAGG + Intergenic
1114092382 14:19301883-19301905 CTCCACCCCCGCGTGGCGGCAGG - Intergenic
1115028030 14:28765955-28765977 CTCCGGCACCGCGGGGAAACCGG - Intergenic
1117119403 14:52552375-52552397 CTCCTCCGTCGCGTGGCGGCGGG - Exonic
1118186487 14:63542940-63542962 CTCCGCCGCCGCGGAACCGGAGG - Exonic
1118647210 14:67851578-67851600 CTCCCCAGCCTGGGGGCAGCAGG + Intronic
1122231199 14:100306975-100306997 CACCGCCGCCGCGGGCGCGCAGG - Intergenic
1122406413 14:101503684-101503706 CTCCTCCTCCCGGGGGCAGCAGG + Intergenic
1123021066 14:105398255-105398277 CTCCGCGCGCGCGGGGCCGCAGG - Intergenic
1124713040 15:32030751-32030773 CGCCGCCGGGGAGGGGCAGCGGG + Intronic
1125509024 15:40282991-40283013 CACCGTCGCTGCGGGGGAGCGGG - Intronic
1125832631 15:42727685-42727707 CTCCGCTCCCCCCGGGCAGCAGG + Exonic
1127433368 15:58933514-58933536 CTCGGCCGCCTCGGGTCAGGCGG - Exonic
1127606001 15:60589479-60589501 CTCCGCTGCCGCGTGACATCTGG + Intronic
1128149849 15:65355898-65355920 CTCCGCCGCCGCGAGTGCGCCGG - Intronic
1129761473 15:78131425-78131447 CTCCGCCGCCGGCGGGAAGAGGG + Exonic
1130076692 15:80695621-80695643 CGCCGCCGCCGCGGCCCAGCCGG + Exonic
1130224557 15:82046987-82047009 CGCCGCCACCGCGGGGACGCAGG + Intergenic
1132745556 16:1434769-1434791 CGCGGACGCCGCTGGGCAGCTGG - Exonic
1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG + Exonic
1134645008 16:15858505-15858527 CTCCCCCGACGCCGGGGAGCAGG - Intergenic
1135976105 16:27109822-27109844 CATCGCCGCTGGGGGGCAGCAGG - Intergenic
1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG + Intronic
1136365295 16:29806676-29806698 CTCGGCCGCAGCGGGGCCCCCGG - Exonic
1138420063 16:56893078-56893100 CCCCGCCCCCGCCGGGCAGGAGG - Intronic
1141103788 16:81216484-81216506 CTCTGCCGCTGCTGGGCAGCAGG + Intergenic
1141683377 16:85556637-85556659 CTCCGCCGCCGCGGCGGAGCCGG - Intergenic
1142421433 16:89972783-89972805 CTCCGCCGGTGCCGGGCGGCTGG + Intergenic
1144021285 17:11241476-11241498 CTCCGTGGACGCTGGGCAGCAGG - Exonic
1144828842 17:18120932-18120954 CACCGGCGCCGCAGGCCAGCTGG + Exonic
1146229486 17:31095281-31095303 CTCCGCCGCCCCCCGGCCGCGGG + Exonic
1146901363 17:36591761-36591783 CTACGCCGGGGCGGGGCAGAGGG + Intergenic
1148246316 17:46033079-46033101 CACCCCAGCGGCGGGGCAGCAGG - Exonic
1148734659 17:49858667-49858689 CTCCGGCGCCCAGGGGCAGGTGG + Intergenic
1148936467 17:51167218-51167240 ACCCGCCGCAGGGGGGCAGCAGG + Intronic
1149461500 17:56833559-56833581 CTCCTCCGCTGCGGAGCGGCGGG - Intronic
1149658880 17:58324379-58324401 CACCGCCGCCCCCGGGTAGCTGG + Intronic
1150003657 17:61456655-61456677 CGCCGCCGCCGCCGCGGAGCAGG + Exonic
1150437322 17:65164192-65164214 CTCATCCACCGTGGGGCAGCTGG + Intronic
1152646012 17:81468900-81468922 CTCAGCCGCCGCGGGGTCACCGG + Intergenic
1152729200 17:81961478-81961500 GCCCCCCCCCGCGGGGCAGCTGG + Intronic
1154125636 18:11689716-11689738 CTTCGCCGCCCCGAGGGAGCAGG - Exonic
1155257919 18:24014670-24014692 CTCCCACGCCGCGCCGCAGCCGG + Exonic
1157464311 18:47930839-47930861 CTCCGCCGCCGCGGCCGCGCGGG + Intronic
1158954699 18:62526615-62526637 CGCCGCCGCCGCCGCGCACCCGG + Intronic
1159770443 18:72542005-72542027 CTGCGCCCGCACGGGGCAGCAGG + Exonic
1160025341 18:75211498-75211520 CCCCGCCGCCGCGCTGCTGCTGG - Intronic
1160960609 19:1719051-1719073 CGCCGCCGCAGCGGGGCTGGGGG + Intergenic
1160967693 19:1753818-1753840 CGCCGCCGCCGCCGTCCAGCAGG - Exonic
1161702953 19:5805024-5805046 CTCGGCCGGCGCGGGGCCGGGGG - Intergenic
1161809700 19:6464749-6464771 CTCGGCCCCAGCGGGCCAGCAGG - Exonic
1162551597 19:11361251-11361273 CTTCGCCAACGCGGGGCAGGTGG + Exonic
1163714646 19:18866691-18866713 CCTCGCCGCCGCGGGCCAGCAGG - Exonic
1164658542 19:29942329-29942351 CGCCGCCGCCGCCCCGCAGCGGG - Exonic
1166039084 19:40191521-40191543 CTCCTCACGCGCGGGGCAGCCGG - Intergenic
1166100359 19:40567979-40568001 CTCCGCCGCCGCGGGGGTCGCGG - Exonic
1166520261 19:43475351-43475373 CTCCGCCGGCGCGGGGCGCGGGG - Exonic
1167074990 19:47243228-47243250 CGCCGCAGCCGCGGGGCTCCGGG + Intergenic
1167391346 19:49196956-49196978 CTTCCCCGCAGCTGGGCAGCAGG + Intronic
1167792189 19:51689523-51689545 CTCCGCCGCCCCGGGCCCGCAGG - Intergenic
1167797581 19:51719769-51719791 CTACGCCGCCGGGGTGCCGCTGG - Exonic
1168069738 19:53942836-53942858 CTACGCCACCCCGGGGCTGCGGG - Exonic
1168076217 19:53982114-53982136 CTCCGCCAACGCGGGCGAGCCGG + Exonic
925036391 2:690086-690108 CTCCTCTGCCCCGGGGCTGCCGG + Intergenic
925088701 2:1134946-1134968 CTCCGCAGCCGCTGGCCAGGGGG + Intronic
927658523 2:24972032-24972054 CCCCGCCGCTGCCTGGCAGCAGG + Exonic
927904286 2:26846531-26846553 CCCCGCCGCCGGGAGGCCGCTGG + Intergenic
927938127 2:27086679-27086701 CGCCTCCGCCGCGGAGGAGCAGG - Intergenic
928549511 2:32357277-32357299 CCCCGCCGCCGAGGAGCAGCCGG - Exonic
932599189 2:73112453-73112475 CTCCGCCGCCGCCTGCGAGCTGG - Exonic
932773696 2:74515007-74515029 CTCCGGAGCTGCCGGGCAGCGGG - Exonic
935622831 2:105144111-105144133 CTGCGCGGCCGCGGCGCCGCCGG - Intergenic
936368619 2:111883977-111883999 CTGCGCCTCCGGGGAGCAGCCGG - Exonic
939432654 2:142130777-142130799 CGCCGCCGCCGCCGGGCCGAAGG - Exonic
940638864 2:156328091-156328113 GGCCGCAGCCGCGGGGCACCAGG + Intronic
942241107 2:173964673-173964695 CGCCGCCGCCGGGGGGCGGGTGG - Intronic
942241109 2:173964676-173964698 CGCCGCCGCCGCCGGGGGGCGGG - Intronic
947558772 2:231126285-231126307 CTCCGCCGCCGCCCAGTAGCTGG - Intronic
947623312 2:231604535-231604557 CTGCGCTGCCGCGGGCCAGGCGG + Intergenic
1168769870 20:408202-408224 GTCCGCCGCCGCCGGGTAGCCGG + Exonic
1169214736 20:3786519-3786541 CGCCGCCGCCCCGGGGCGGGGGG + Exonic
1171823144 20:29873972-29873994 CACCGCCACCCCGGGGCCGCTGG - Intergenic
1171896960 20:30816339-30816361 CACCGCCACCCCGGGGCCGCGGG + Intergenic
1172276969 20:33685313-33685335 CTCTGCAGGGGCGGGGCAGCTGG - Intronic
1172295931 20:33811320-33811342 CTCCGCCTCCGCCCCGCAGCTGG - Exonic
1172640189 20:36436105-36436127 CGCCGCCGCCGCCGGGCACCTGG - Exonic
1175847596 20:62066483-62066505 CCAAGCCGCCGCGGGGAAGCTGG + Intergenic
1177157358 21:17513026-17513048 CGCCGCCGCCGCGAGCCAGTCGG + Exonic
1180488346 22:15820683-15820705 CTCCACCCCCGCGTGGCGGCAGG + Intergenic
950168026 3:10816206-10816228 CGCCGCCGCCCCGGGCGAGCTGG - Exonic
950487831 3:13283179-13283201 CGGCGCGTCCGCGGGGCAGCGGG - Intergenic
950903002 3:16513716-16513738 CGCCGCCGCCGCGCGTCCGCCGG + Intronic
952816667 3:37452698-37452720 CTCGGCCGCCGGGGGACGGCGGG + Intronic
953561223 3:43995283-43995305 CTCGACCGCCGCGGCGCTGCAGG - Intergenic
954247013 3:49340028-49340050 CTCCGCGGCCCCGGCCCAGCCGG + Exonic
955387595 3:58492000-58492022 CGCCGCCCGCGCCGGGCAGCTGG + Intergenic
960582782 3:119294798-119294820 CCCCAGAGCCGCGGGGCAGCCGG + Exonic
960896748 3:122514379-122514401 CTGCGCCGCGGCCGGGCGGCGGG - Intronic
961326298 3:126111409-126111431 CTCAGGGGCAGCGGGGCAGCGGG - Intronic
966982603 3:185152527-185152549 CTCTGCGGCCGCGGGGCTCCGGG - Intronic
967217825 3:187225287-187225309 CTCCACCTCTGCAGGGCAGCTGG - Intronic
968701305 4:2059409-2059431 CGCCGCCGCCGCGGGTCCGAGGG + Intergenic
969330835 4:6472675-6472697 CTCCGCCCCCGCGGCCCTGCAGG + Intronic
969405312 4:6987435-6987457 CTCCACCTGCGCGGGGCCGCAGG - Intronic
969429376 4:7145268-7145290 CTCAGCTGCCCAGGGGCAGCAGG - Intergenic
970202880 4:13627489-13627511 CGCCGCCGCCGCCGGGCCCCGGG - Exonic
973775009 4:54233999-54234021 TTCCGCCCCCTCGGGGCAGGGGG - Intronic
975812261 4:78181785-78181807 CGCCAACGCTGCGGGGCAGCGGG + Intronic
980541441 4:134201532-134201554 CGCCGCCGCCGAGGCGCTGCCGG + Intronic
982245252 4:153344632-153344654 CTCCGCCCCCGCGGCGTAGTCGG + Exonic
982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG + Intergenic
984811094 4:183797356-183797378 CTCCGCCCCCGCGGGGCCGCTGG + Intergenic
985444576 4:190015051-190015073 CACCGCCACCCCGGGGCAGCGGG - Intergenic
986747923 5:10760795-10760817 CTTCGCCGCCGCCGGCAAGCGGG + Intronic
988100398 5:26669489-26669511 CTTTGCCCCCGCCGGGCAGCTGG + Intergenic
990557748 5:56952199-56952221 CTCCGCCGCCGGGCGGGTGCCGG - Intronic
991676526 5:69094179-69094201 CGCCGCTGCCGCGGAACAGCGGG - Exonic
991715614 5:69448394-69448416 CTCCGGAGCAGCTGGGCAGCTGG + Intergenic
992530262 5:77645779-77645801 CTCCGCCTCGGCTGGGCGGCCGG + Intergenic
992716251 5:79514044-79514066 CTCCGCCTCCGCCGGCCGGCCGG + Exonic
993503911 5:88689676-88689698 CTCATCTGCCGCGGGGCTGCCGG + Intergenic
994710595 5:103259437-103259459 TTCCCGCACCGCGGGGCAGCGGG + Intronic
995724679 5:115170263-115170285 CTCCGCTGCAGCAGAGCAGCCGG + Intronic
996082262 5:119268954-119268976 CTCTCCCGCCGCTGGGCTGCGGG + Intronic
998203944 5:140146066-140146088 CTCCGCCGCCGCAGACCAGCCGG + Intergenic
1002524059 5:179806075-179806097 CCAGGCCGGCGCGGGGCAGCAGG + Intronic
1002906182 6:1451043-1451065 CTCCTCAGCCGCGGAGCACCTGG - Intergenic
1007072838 6:39049183-39049205 CAGGGCGGCCGCGGGGCAGCGGG - Intronic
1008013368 6:46491363-46491385 CTCTGCCGCCGTGGGTCAGTGGG + Intronic
1009510187 6:64540979-64541001 CTCAGCCGCCGTGGAGCAACAGG - Intronic
1009622440 6:66094799-66094821 CTGCCCCGCCGCGGGACAGCTGG - Intergenic
1010703400 6:79078103-79078125 CCCCGCCGCCGAGGGGAAGCGGG + Exonic
1013793557 6:113859927-113859949 CTCCGCGGCCGTGGGCGAGCCGG - Exonic
1018238411 6:161748975-161748997 ACCCGCCGCCAGGGGGCAGCTGG + Intronic
1019343438 7:518962-518984 ATCCGCAGCCGAGGAGCAGCAGG + Exonic
1019422834 7:958964-958986 TTCCTCCCCCGCTGGGCAGCTGG + Intronic
1019455497 7:1124851-1124873 CTCCCGCGCAGCGGGTCAGCAGG - Intronic
1019898223 7:3999555-3999577 CTCCCCCGCCCCGAGGCACCAGG - Intronic
1021998521 7:26202230-26202252 CGCCGCAGCCTCGGGACAGCCGG - Intronic
1022427950 7:30285542-30285564 CGCGGCCGCCGCGGCGCCGCCGG - Exonic
1024249353 7:47494734-47494756 CTCCGCCTCCCGGGAGCAGCTGG - Intronic
1024579920 7:50793242-50793264 CGCCGCCTCCGCGTGGCTGCGGG + Intronic
1025069676 7:55887590-55887612 CGCCGCCGCCGCGGTGGACCCGG - Intronic
1029640334 7:101816184-101816206 CCCCGCCGCCGCGGGCCCCCCGG - Intronic
1032130756 7:129225361-129225383 CGCCGCCGTCGCGGTGCCGCTGG - Exonic
1032239428 7:130149511-130149533 CCCGGCCGCCCCGGGGGAGCAGG - Intergenic
1033366133 7:140673538-140673560 GTCCGCTGCAGCGGGGCGGCTGG + Exonic
1037336891 8:17801015-17801037 CACCCCGGCCGCCGGGCAGCGGG + Intergenic
1038613143 8:29071816-29071838 CTCGGCCCCCGGGGAGCAGCCGG + Exonic
1039466324 8:37787874-37787896 CTCCACCGCCTCTGGGGAGCAGG + Intronic
1041449797 8:57994648-57994670 GGTCGCCGCCGCGGGGCCGCGGG - Exonic
1042020568 8:64369383-64369405 CTTCGCGGCCGAGGGGCTGCCGG + Intergenic
1044306403 8:90645752-90645774 CCCCGCCCCCGCGGGGAAGGCGG + Exonic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1047998403 8:130357961-130357983 CGCCGCTGCCGCCGCGCAGCTGG - Intronic
1048980937 8:139703208-139703230 CACCGCCACCGCGAGGCGGCTGG + Intergenic
1049218555 8:141418571-141418593 CTCAGCCTCCTCGGGCCAGCAGG - Intronic
1049525278 8:143122316-143122338 CTCCGCCCTCACGGGGCTGCGGG - Intergenic
1049936314 9:504597-504619 CGCCGCCGGGGCGGGGAAGCCGG - Intronic
1052888894 9:33677197-33677219 CGCCGCCGCCGCGCCTCAGCCGG + Intergenic
1053066318 9:35071991-35072013 CTCCGCCGGCGCGGCGCCCCGGG - Intronic
1053550925 9:39078739-39078761 CGCCGCCCCCGCTGCGCAGCGGG + Exonic
1053815034 9:41898818-41898840 CGCCGCCCCCGCCGCGCAGCGGG + Exonic
1053865680 9:42435411-42435433 CTCTGCCGCCTCAGGGCAGTAGG - Intergenic
1054245702 9:62663358-62663380 CTCTGCCGCCTCAGGGCAGTAGG + Intergenic
1054336285 9:63813103-63813125 CACCGCCACCCCGGGGCCGCGGG - Intergenic
1054615562 9:67288623-67288645 CGCCGCCCCCGCCGCGCAGCGGG - Intergenic
1054835650 9:69672545-69672567 CGCCGCCGCCGCGGGCTCGCGGG - Intergenic
1056757388 9:89390362-89390384 CTGCGGGGCTGCGGGGCAGCTGG + Intronic
1056985575 9:91361591-91361613 CTGGGCAGGCGCGGGGCAGCGGG - Intronic
1057489151 9:95508376-95508398 CGCCGCCGCCGCGGGGACGGAGG + Exonic
1057773157 9:97984458-97984480 CGCCGCCGCCGCGGCACAGGGGG - Intronic
1061540736 9:131276918-131276940 CTCGGCGGCCGCGGCGAAGCAGG - Intergenic
1061656978 9:132099796-132099818 CTCCGCCTCCGTGGGGGACCAGG + Intergenic
1061828441 9:133275546-133275568 CCCCGCCTCCCCGGGGGAGCAGG - Intergenic
1061987094 9:134136179-134136201 CCCCGCCGCCGCGGCCCGGCAGG + Exonic
1203376215 Un_KI270442v1:380521-380543 CACCGCCACCCCGGGGCCGCGGG - Intergenic
1185734923 X:2489243-2489265 CTCCGCCTTCGAGCGGCAGCAGG - Exonic
1188003523 X:25002639-25002661 CGCCGCCGCCGCCGGCCAGTCGG - Intergenic
1188744796 X:33829291-33829313 CTGCTCTGCCGAGGGGCAGCCGG - Intergenic
1189075024 X:37905862-37905884 CGCCGCCGCCTGGGGGCATCCGG + Intronic
1189262524 X:39688870-39688892 CGCCGCCGCCGCGGCTCTGCAGG + Intergenic
1195716823 X:107826233-107826255 CGCCGACGCCGCGCAGCAGCCGG - Exonic
1201065829 Y:10093058-10093080 CACCGCCATCCCGGGGCAGCGGG + Intergenic