ID: 1072072805

View in Genome Browser
Species Human (GRCh38)
Location 10:91936332-91936354
Sequence CCTGATGTGCAGAGTAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072072803_1072072805 17 Left 1072072803 10:91936292-91936314 CCTGTATGGTAATAAGTGGCAAA 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1072072805 10:91936332-91936354 CCTGATGTGCAGAGTAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072072805 Original CRISPR CCTGATGTGCAGAGTAAAGC AGG Intronic
No off target data available for this crispr