ID: 1072076918

View in Genome Browser
Species Human (GRCh38)
Location 10:91985593-91985615
Sequence TCTCACATACTGATGGTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072076918_1072076922 13 Left 1072076918 10:91985593-91985615 CCTCTGACCATCAGTATGTGAGA 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1072076922 10:91985629-91985651 CACATCATCAATATTTGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072076918 Original CRISPR TCTCACATACTGATGGTCAG AGG (reversed) Intronic
901080738 1:6582438-6582460 TCTCACTTCCTGATTATCAGAGG - Intronic
906199520 1:43950132-43950154 TCTCACAGCCTGATGCCCAGAGG + Exonic
911690998 1:100834812-100834834 TCTCACATACTGATGATACCAGG - Intergenic
911930944 1:103902774-103902796 TAAGACATACTGATGGCCAGTGG - Intergenic
916192212 1:162190903-162190925 GGTCACATTCTGATGGTCTGAGG + Intronic
918227181 1:182494621-182494643 TCTCTGATACTGATGGTAAATGG + Intronic
918393168 1:184087719-184087741 TCTCACATCCAAATGGTCATGGG - Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
923977288 1:239277495-239277517 TCTCTGACACTGAGGGTCAGAGG + Intergenic
1062970543 10:1644865-1644887 TCTCAAATAGTGATGGCTAGGGG + Intronic
1063430579 10:5984849-5984871 GGTCACATTCTGAGGGTCAGGGG + Intergenic
1063971764 10:11385987-11386009 TCCCACATAATGCTGGTCATGGG - Intergenic
1065540580 10:26762424-26762446 TCTCAGATACTGATTGTCTGGGG + Intronic
1069779964 10:70949040-70949062 TCTCTCATAATGATAGTGAGTGG + Intergenic
1072076918 10:91985593-91985615 TCTCACATACTGATGGTCAGAGG - Intronic
1073537209 10:104288476-104288498 TTTCACATACTGCTGGTGAGGGG - Intronic
1074503718 10:114048114-114048136 TCTTACATACTCATGGTCGGGGG - Intergenic
1080095671 11:28403458-28403480 TATCACACAATGATGTTCAGAGG + Intergenic
1084882251 11:72179895-72179917 AGTCACATACTGATGGGCATTGG + Intergenic
1086257817 11:84900054-84900076 TGTAAGATACTGAAGGTCAGAGG - Intronic
1095126917 12:38490335-38490357 CCTCAGATACTGATGGGGAGGGG + Intergenic
1098098130 12:66982502-66982524 TCTCTCATTCTGTTGCTCAGTGG + Intergenic
1098423408 12:70329761-70329783 GCTCGCATACTGGTTGTCAGTGG + Intronic
1098911315 12:76211935-76211957 TCTCACAATCTCATGATCAGAGG - Intergenic
1102661325 12:114531395-114531417 TCTCACTGACTGTTGGCCAGAGG - Intergenic
1105211411 13:18259215-18259237 TCTCCCAGGCTGATGTTCAGCGG + Intergenic
1105533045 13:21237358-21237380 TCTCACACACAGCTGGTCTGTGG - Intergenic
1112689038 13:101868715-101868737 TCTTACTTACTGATGGGTAGAGG + Exonic
1115233157 14:31183138-31183160 TTTCACATACTGATTGCTAGAGG - Intronic
1118994640 14:70824569-70824591 CCTCAAAGACTGATGGTCAAGGG - Intergenic
1131828512 15:96339461-96339483 TCTCACAGACTGAAGGTAAAGGG - Exonic
1132600227 16:769817-769839 TCCCACTTTCTGCTGGTCAGTGG + Intronic
1135188219 16:20333256-20333278 TCTCACCTCCTGCTGGGCAGGGG - Exonic
1138407698 16:56811217-56811239 TCTCACATACTGCTGGTGGGAGG - Intronic
1139063707 16:63287696-63287718 TCTGACATCCTGTTGGTCTGAGG + Intergenic
1140765777 16:78155342-78155364 GGTCACAAACTGATGATCAGAGG - Intronic
1141066421 16:80917403-80917425 ACTCACATAGAGATGGGCAGCGG - Intergenic
1142140322 16:88469873-88469895 TCTCACGTGGTGAGGGTCAGAGG + Intronic
1143144642 17:4766678-4766700 TCTGAAATACTGAATGTCAGAGG - Intergenic
1146968328 17:37052093-37052115 ACACACACACTCATGGTCAGTGG - Intronic
1153211339 18:2768390-2768412 TCCCATATACTGCTGGTGAGAGG + Intronic
1156141807 18:34121422-34121444 TCTTACACACTGCTGGTCTGTGG + Intronic
1157283988 18:46364731-46364753 GCTCACATACTGATGGAGGGTGG + Intronic
1158332664 18:56380046-56380068 TTTCACCTACTCATGCTCAGAGG + Intergenic
1158786275 18:60715703-60715725 TATCAATTAGTGATGGTCAGAGG + Intergenic
1160238863 18:77108023-77108045 TCTCACTTACCGGTGCTCAGGGG - Intronic
1164450886 19:28363407-28363429 TCTCACTGACTGCTGATCAGAGG + Intergenic
1166153743 19:40894557-40894579 TCTCCCATACTGAAGTGCAGTGG - Intronic
1166703259 19:44894229-44894251 ACTCACCCACTCATGGTCAGTGG - Intronic
1166783574 19:45354632-45354654 TCTCACACTCTGATGGTGACAGG - Intronic
925518181 2:4708412-4708434 ACTCACATACTGAGGGGAAGAGG - Intergenic
925555859 2:5131143-5131165 TCTCACATTCCTATGGTCATTGG - Intergenic
926326948 2:11793191-11793213 TCTCACCCACAGATGGACAGTGG - Intronic
939440503 2:142243505-142243527 TCTCACATATTGATGATGGGAGG + Intergenic
941808315 2:169732368-169732390 TCTGACAAAGTGATGGTGAGTGG - Intronic
941925506 2:170890190-170890212 TCTCAGATATTTATAGTCAGTGG + Intergenic
945088417 2:206156946-206156968 ACACACATACTGATTGTCAGTGG - Intronic
946078809 2:217098602-217098624 TTTCACCTTCTGATGGTCAGTGG + Intergenic
946649591 2:221876631-221876653 TCTCACATTCTGTAGGTCACCGG + Intergenic
948199528 2:236119746-236119768 TCTCACACACCGATGCACAGGGG - Intronic
948417781 2:237827308-237827330 CCTCAGATACTGAAGGGCAGAGG - Exonic
1169175648 20:3510376-3510398 TTTCACATACTTATAGTCAATGG - Intronic
1169246028 20:4025563-4025585 TCCCACATACTGTTGGAAAGAGG + Intergenic
1175458775 20:59135212-59135234 TCTCACAATCTGTTTGTCAGAGG + Intergenic
1176025545 20:62983518-62983540 TCACACTGACTGATGGTCACAGG - Intergenic
1177126634 21:17201850-17201872 TCTCACACAGGGATGGTAAGAGG + Intergenic
1180764822 22:18340223-18340245 TCTCCCAGGCTGATGTTCAGCGG - Intergenic
1180814208 22:18779461-18779483 TCTCCCAGGCTGATGTTCAGCGG + Intergenic
1180860100 22:19073912-19073934 TCTCCCACACTGATGGTGAACGG + Intronic
1181200393 22:21213796-21213818 TCTCCCAGGCTGATGTTCAGCGG + Exonic
1181701344 22:24623163-24623185 TCTCCCAGGCTGATGTTCAGCGG - Exonic
1183477788 22:38045506-38045528 TCTCCCATACTGGAGTTCAGTGG - Intergenic
1185233794 22:49699633-49699655 CCTCACATGTTGCTGGTCAGTGG + Intergenic
1203226444 22_KI270731v1_random:81128-81150 TCTCCCAGGCTGATGTTCAGCGG - Intergenic
1203264306 22_KI270734v1_random:5148-5170 TCTCCCAGGCTGATGTTCAGCGG + Intergenic
949389056 3:3538342-3538364 TCTCATCTACTGCTGATCAGTGG - Intergenic
952228754 3:31407257-31407279 TGTCACAGACTGTAGGTCAGTGG - Intergenic
952371783 3:32729524-32729546 TCTCAGAAACTGCTGTTCAGCGG - Intronic
952817748 3:37460255-37460277 TCTCACATATTGTTGGTCACTGG - Intronic
953940734 3:47093781-47093803 TCTCATACACTGTTGGTGAGGGG - Intronic
957628201 3:82682104-82682126 TCTCAAATAATTATGGTTAGTGG - Intergenic
958518868 3:95158312-95158334 TCTCATATAATGCTGGTAAGTGG + Intergenic
959478790 3:106845876-106845898 TCTTACATCCTGGAGGTCAGAGG - Intergenic
960790225 3:121421941-121421963 TCTCACAAACTCCTGGTTAGTGG + Exonic
962258015 3:133885402-133885424 GCTCACACACTAATGATCAGAGG + Intronic
963463422 3:145646543-145646565 TCTTGCATAATGATTGTCAGTGG + Intergenic
963775771 3:149437860-149437882 TGTCACATAAAGATGGTCACAGG + Intergenic
964626889 3:158768356-158768378 TCTCAGTTACTGATGGACAATGG + Intronic
964679280 3:159319234-159319256 GCTCACATTCAGATGGTGAGTGG - Intronic
974324932 4:60401848-60401870 TTTCACATACTGGTGGTTAAGGG - Intergenic
974662554 4:64912051-64912073 TCTCACACAGTGATGATAAGAGG - Intergenic
975786927 4:77900622-77900644 TATCAGATACTGGTGGTCAATGG + Intronic
979753218 4:124305152-124305174 TGCCACATGTTGATGGTCAGAGG - Intergenic
980320515 4:131266966-131266988 TGTCTCATACTGATGGCCAGTGG - Intergenic
980432029 4:132713744-132713766 TCTCACATACTAATGGGGAAAGG - Intergenic
981697283 4:147572061-147572083 TTTCACATAGTGATGGGCATAGG + Intergenic
981769502 4:148291490-148291512 ACTGACATACTGATAGTAAGAGG - Intronic
988876095 5:35447622-35447644 TCTCCCAGACTGAAGTTCAGTGG + Intergenic
994840184 5:104914010-104914032 TTTCCCACACTGATGGCCAGGGG + Intergenic
998369053 5:141649607-141649629 TCTCCCATGGTGTTGGTCAGGGG - Intronic
999331390 5:150675917-150675939 TCACACATGCTGCTGGTTAGAGG - Intronic
1000054404 5:157592162-157592184 TCTCACATCCTCAGGCTCAGAGG + Intergenic
1003085631 6:3058575-3058597 TTTCACATATTGAAGGTCTGTGG + Intergenic
1006297261 6:33175406-33175428 TCTCAGCTGCTGATGGGCAGAGG - Intronic
1007019644 6:38506473-38506495 TCTCTCATGCTGCTGGGCAGTGG - Intronic
1009685048 6:66945679-66945701 TCTCACTGACAGATGGACAGTGG + Intergenic
1011145597 6:84211708-84211730 TCTAACATAATTAGGGTCAGAGG + Intronic
1015824147 6:137294127-137294149 TCTCTCTGACTGTTGGTCAGAGG - Intergenic
1016215285 6:141592844-141592866 ACTCAAATACTGAGAGTCAGTGG - Intergenic
1019655300 7:2190864-2190886 TCTCACACACGGGTGGCCAGGGG + Intronic
1022780220 7:33574304-33574326 TCTCACCAACTGTGGGTCAGTGG + Intronic
1031088953 7:117329867-117329889 TCTAACATACTCATAGTGAGTGG + Intergenic
1031646488 7:124232211-124232233 TCTCTCATACTGATGTTTATTGG + Intergenic
1031646912 7:124237235-124237257 TCTCTCATACTGATGTTTATTGG + Intergenic
1031647330 7:124242231-124242253 TCTCTCATACTGATGTTTATTGG + Intergenic
1034477197 7:151292254-151292276 TGTCCAATAGTGATGGTCAGTGG - Intergenic
1038898393 8:31813642-31813664 TCCCAGATAGTGAGGGTCAGGGG - Intronic
1040510438 8:48088577-48088599 TCTCACATATTGAGGATCACTGG + Intergenic
1042994729 8:74683884-74683906 TGTCACATACTGAAGTTCCGTGG - Intronic
1044818872 8:96142267-96142289 TCTCACAGAATTATTGTCAGAGG - Intergenic
1045250791 8:100482168-100482190 TCTCACCTACTCAAGGTGAGGGG - Intergenic
1046570857 8:115964083-115964105 TCTGACAACCTGATGGTCATGGG - Intergenic
1049176015 8:141193202-141193224 GCTCACATTCTGAGGTTCAGAGG + Intronic
1051501386 9:17781665-17781687 TCTCAAATACTGCTGGTAGGAGG - Intronic
1051877356 9:21806453-21806475 TCCCAGATACTGCTGGTTAGGGG + Intronic
1053154399 9:35765755-35765777 TCTCATATAATGCTGGTAAGTGG - Intergenic
1053829917 9:42068017-42068039 TCCCAGATACTGATGAGCAGGGG - Intronic
1054814929 9:69465792-69465814 TCTCCCAGAATGATGGACAGTGG - Intronic
1056318338 9:85413553-85413575 TCTTATATACTGCTGGTGAGAGG - Intergenic
1058101321 9:100920439-100920461 TCTCACTGGCTGCTGGTCAGAGG + Intergenic
1058114957 9:101074668-101074690 TACCACATAGTGATGCTCAGTGG - Intronic
1058763807 9:108162135-108162157 TCTCACTTATTGATGATCTGGGG - Intergenic
1059194801 9:112360622-112360644 TGTTACAAATTGATGGTCAGAGG - Intergenic
1059642978 9:116235417-116235439 TCCCAGAGTCTGATGGTCAGTGG - Exonic
1061661224 9:132131533-132131555 TCTCCCCTACAGATGGTGAGGGG + Intergenic
1193159561 X:78213511-78213533 TCTCGCACACTGATGGTCAAAGG + Intergenic
1193471149 X:81906203-81906225 TCTCACAGACTGAAGGTAAAGGG - Intergenic
1194355867 X:92883144-92883166 TCTCCCATTCTGTTGGTCATCGG - Intergenic
1196001336 X:110790188-110790210 ACACACATAATGATGCTCAGTGG + Intronic