ID: 1072078195

View in Genome Browser
Species Human (GRCh38)
Location 10:92000250-92000272
Sequence CAACCCATTTGGTTTAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 97}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072078195_1072078198 -7 Left 1072078195 10:92000250-92000272 CCACCTTTAAACCAAATGGGTTG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1072078198 10:92000266-92000288 TGGGTTGTACTTAGTCTCCTTGG No data
1072078195_1072078203 26 Left 1072078195 10:92000250-92000272 CCACCTTTAAACCAAATGGGTTG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1072078203 10:92000299-92000321 GCTTTGGAATAAGTGAGCAGTGG No data
1072078195_1072078204 27 Left 1072078195 10:92000250-92000272 CCACCTTTAAACCAAATGGGTTG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1072078204 10:92000300-92000322 CTTTGGAATAAGTGAGCAGTGGG No data
1072078195_1072078200 10 Left 1072078195 10:92000250-92000272 CCACCTTTAAACCAAATGGGTTG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1072078200 10:92000283-92000305 CCTTGGCCCTTTCTTAGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072078195 Original CRISPR CAACCCATTTGGTTTAAAGG TGG (reversed) Intronic
912147124 1:106807732-106807754 CAAACATTTTGGTTTAGAGGAGG + Intergenic
912151515 1:106864404-106864426 CAACACATTTTCATTAAAGGAGG + Intergenic
912678806 1:111714573-111714595 CAGTCCACTTGGGTTAAAGGTGG + Exonic
913679059 1:121171405-121171427 CAGCACAATTGGTTCAAAGGAGG + Intronic
914030892 1:143959051-143959073 CAGCACAATTGGTTCAAAGGAGG + Intronic
914158558 1:145108911-145108933 CAGCACAATTGGTTCAAAGGAGG - Intronic
916354508 1:163889804-163889826 CATCCCCTTTGCTTTAAAGTAGG + Intergenic
920466359 1:206189943-206189965 CAGCACAATTGGTTCAAAGGAGG + Intronic
921061593 1:211589743-211589765 CATCCCTTTTAGATTAAAGGAGG + Intergenic
921516370 1:216097694-216097716 CAAACCATTTGGTTATAGGGTGG - Intronic
923773465 1:236958044-236958066 CAATCCATTCCATTTAAAGGGGG + Intergenic
1063048796 10:2422462-2422484 CTACCCATTTGGTCCTAAGGAGG - Intergenic
1066402197 10:35087421-35087443 CCACACATCTGGTTTAAAGCTGG + Intronic
1070481178 10:76884339-76884361 TAACCCTCCTGGTTTAAAGGAGG + Intronic
1072078195 10:92000250-92000272 CAACCCATTTGGTTTAAAGGTGG - Intronic
1081676083 11:44970428-44970450 CAAGCAATTTGGTTTGAAGCAGG - Intergenic
1086743172 11:90392688-90392710 CAACCCTCTTAGTTTAAATGAGG + Intergenic
1095162907 12:38937643-38937665 CACCTCATATGGCTTAAAGGTGG - Intergenic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1103269946 12:119664980-119665002 CAACCCATTTGTTTTATATAAGG - Intergenic
1109807986 13:67469409-67469431 AAATCCATTTAGTTTAATGGGGG + Intergenic
1111284362 13:86068754-86068776 CATCTCATTTGGCTTATAGGTGG - Intergenic
1112127322 13:96482368-96482390 CATTCTATTTGGTTTCAAGGAGG - Intronic
1113922123 13:113919140-113919162 CGACCCATTGGGTTATAAGGTGG + Intergenic
1115322058 14:32092621-32092643 GCACCCATGTGGTTTAAAGGCGG - Exonic
1115348090 14:32364462-32364484 CTACCCAATTTGTTGAAAGGGGG + Intronic
1117332769 14:54729731-54729753 CTACACATTTGCTTCAAAGGTGG + Intronic
1117815404 14:59592845-59592867 CAACATATCTGGTTTAAGGGTGG - Intergenic
1130090808 15:80819673-80819695 CAGCCTATTTTGTTTTAAGGAGG + Intronic
1131213755 15:90519829-90519851 AAACCCATTTTTTTAAAAGGTGG - Intergenic
1144290408 17:13820952-13820974 CAACCTATCTGGAGTAAAGGAGG - Intergenic
1145951858 17:28824776-28824798 CAACCCATTTCTTTTTGAGGTGG + Intronic
1154291412 18:13111086-13111108 CAACTCAATTGGATCAAAGGAGG - Intronic
1157687599 18:49655169-49655191 CAACCCATTTGGAATATAGAGGG + Intergenic
1160223658 18:76995999-76996021 CAAACAATTTGGTTTAAAAATGG + Intronic
1161293460 19:3507595-3507617 CAACCTATGTGCTTTGAAGGAGG + Intronic
1164408246 19:27973964-27973986 CAATTCTGTTGGTTTAAAGGTGG - Intergenic
926779351 2:16453591-16453613 TAACTCATTTTGTTTAGAGGAGG + Intergenic
935956027 2:108377488-108377510 CATCCCTTTTGCTTTAAATGAGG + Intergenic
936628043 2:114169898-114169920 CAACCACTTTATTTTAAAGGTGG + Intergenic
941892498 2:170596587-170596609 CCACCCATGAGGTTTATAGGGGG + Intronic
942666852 2:178328807-178328829 CAACCCATGTGGTTAAAATAAGG - Intronic
945889749 2:215416947-215416969 CAGTCCATTTCCTTTAAAGGTGG - Intronic
946726422 2:222665867-222665889 AAGTCCATTTGATTTAAAGGCGG + Intergenic
948066471 2:235084550-235084572 CAACCCATTTGATCTTAAGGAGG + Intergenic
1168740818 20:189912-189934 CAACCCATTTGGGTCAAGGTTGG + Intergenic
1175623614 20:60472157-60472179 CATCCCAGTAGGTTTTAAGGTGG + Intergenic
1175679730 20:60977137-60977159 CAGCCCCTTTGGTTCAAAGATGG + Intergenic
1178709938 21:34907901-34907923 CAATCCATTTAGTTTATAGAGGG + Intronic
1181714688 22:24716007-24716029 CAATCCAGGTGGTTTAAAGGTGG + Intergenic
955345963 3:58162076-58162098 CAACACATTGGCTTTAAGGGAGG + Intronic
955470632 3:59282755-59282777 TAACACATTTGCTTTAAATGAGG - Intergenic
956259101 3:67317427-67317449 CAACCCCTTTGCTTCAAAGTGGG - Intergenic
956480824 3:69672398-69672420 CAACCCATATACTTTCAAGGGGG - Intergenic
956832389 3:73064065-73064087 CAACCCATTTGTTGTCATGGGGG - Exonic
957215551 3:77316256-77316278 CAGACCATTTGGTGTAAAAGAGG + Intronic
962321062 3:134390749-134390771 CAACCCAGTGGATTTAAATGGGG + Intergenic
962791291 3:138813911-138813933 CAACCTAAATGGTTTGAAGGAGG + Intronic
965356753 3:167684639-167684661 CAACCCAGTTCATTTATAGGTGG + Intronic
965868926 3:173242645-173242667 TATCACATTTGGTTGAAAGGGGG + Intergenic
966222475 3:177564639-177564661 CACTCCATGTGGTTTAAATGGGG - Intergenic
966496999 3:180592565-180592587 CAATCCCTTAGTTTTAAAGGTGG + Intergenic
966795320 3:183707986-183708008 CTTCCCATCTGGTTTAAAGTTGG - Intronic
970900335 4:21151559-21151581 CAAGCTCTTTGGTTTATAGGGGG + Intronic
971228559 4:24778435-24778457 CAACACATTTTGTTTAAATAAGG + Intergenic
973628222 4:52793607-52793629 AAATCCATTTGGTTTTGAGGTGG + Intergenic
974247541 4:59339992-59340014 CAACAAATTTTGTTTAAATGAGG - Intergenic
974505588 4:62766803-62766825 CAACCAATTTCTCTTAAAGGAGG + Intergenic
978613270 4:110567682-110567704 CCAGCCTTTTGGTTTAAAGGTGG - Intergenic
979141932 4:117187077-117187099 TAAAACATTAGGTTTAAAGGAGG - Intergenic
979817106 4:125122687-125122709 AAACCCATTTGGATGTAAGGTGG + Intergenic
981624777 4:146742799-146742821 CAACTATTTTGGTTTAAAGGAGG - Intronic
983975081 4:173923959-173923981 CAATGCATTTGTTTTAAAGACGG - Intergenic
986509674 5:8491036-8491058 CTAGCCCTGTGGTTTAAAGGTGG - Intergenic
989699887 5:44250891-44250913 CAGCCCATGTGGTTTAGATGGGG + Intergenic
989739203 5:44749591-44749613 CTCACCATGTGGTTTAAAGGTGG + Intergenic
989784543 5:45312101-45312123 CATTCCATTTGGTTGAAAGGTGG - Intronic
992762490 5:79962899-79962921 AATCCCATTTGGTTAACAGGAGG + Intergenic
996030098 5:118695281-118695303 CAAAACATATTGTTTAAAGGGGG + Intergenic
999257076 5:150215710-150215732 CAACCCACTTGTTTTATAGATGG - Intronic
1010679079 6:78778793-78778815 CCACCCACTTGTTTCAAAGGGGG + Intergenic
1011986461 6:93453023-93453045 GACCAAATTTGGTTTAAAGGTGG + Intergenic
1013776558 6:113684913-113684935 CAACTCTTTTGTTTTAAAAGAGG + Intergenic
1015068645 6:129061677-129061699 CCTCCCATTTAGTTTAATGGAGG + Intronic
1015525361 6:134170823-134170845 CACCACATTTGGGTTAAAAGGGG + Exonic
1016334122 6:142985754-142985776 CTTCACATTTGATTTAAAGGAGG - Intergenic
1029167994 7:98609103-98609125 CAGCCCATCTGGGTTACAGGGGG - Intergenic
1029353107 7:100029615-100029637 CAACCCTTTTATTTTAAAGAAGG - Intronic
1030863038 7:114660396-114660418 CAAGCCATTTGGTACAAAAGGGG + Intronic
1032527780 7:132592936-132592958 CAAATAATTTGGTTTAGAGGAGG + Intronic
1039125465 8:34196651-34196673 CAAGAGATTTGGTTTAAAGGAGG - Intergenic
1041988245 8:63953202-63953224 CAACCCATATGGTTAGATGGAGG - Intergenic
1042039838 8:64579596-64579618 CAGCCCATTTTTTTTTAAGGTGG - Intergenic
1045870031 8:106915925-106915947 CCACCCATCTTGTGTAAAGGAGG + Intergenic
1050967679 9:11827990-11828012 CATCCACTTTTGTTTAAAGGGGG + Intergenic
1058239830 9:102542776-102542798 CAACCCCTATGGTTTCATGGAGG + Intergenic
1058508297 9:105688986-105689008 CAACCCATTTATTTTAAAGTAGG - Intergenic
1059377225 9:113892756-113892778 GAATATATTTGGTTTAAAGGAGG + Intronic
1187429800 X:19211615-19211637 CAAATCATTTGATTAAAAGGAGG + Intergenic
1189283958 X:39838914-39838936 CAAGCCCTTTGGATGAAAGGAGG - Intergenic
1189549224 X:42075899-42075921 CAACCCATTTGTTTTGCAGATGG - Intergenic
1190423363 X:50308634-50308656 AAAGCCATTAGTTTTAAAGGAGG + Exonic
1192408452 X:70910368-70910390 CAAGCCATTTGGTTTGGAGATGG - Intergenic
1194492549 X:94569470-94569492 CAAGCCCTGTGTTTTAAAGGTGG + Intergenic
1197149716 X:123206907-123206929 CAATCCATTTGTTTTAAAACTGG + Intronic
1197846411 X:130808569-130808591 CCACCAATTAGGTTAAAAGGAGG + Intronic