ID: 1072080483

View in Genome Browser
Species Human (GRCh38)
Location 10:92025104-92025126
Sequence ATGTAGTTCTATAGTTAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 341}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072080483_1072080485 19 Left 1072080483 10:92025104-92025126 CCTTTTTAACTATAGAACTACAT 0: 1
1: 0
2: 0
3: 24
4: 341
Right 1072080485 10:92025146-92025168 ATTTGCTTAGCATATGAAAAGGG 0: 1
1: 0
2: 3
3: 21
4: 269
1072080483_1072080484 18 Left 1072080483 10:92025104-92025126 CCTTTTTAACTATAGAACTACAT 0: 1
1: 0
2: 0
3: 24
4: 341
Right 1072080484 10:92025145-92025167 TATTTGCTTAGCATATGAAAAGG 0: 1
1: 0
2: 4
3: 25
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072080483 Original CRISPR ATGTAGTTCTATAGTTAAAA AGG (reversed) Intronic
902356235 1:15903140-15903162 ATGTAGTTCTGTTTGTAAAATGG + Intronic
902686788 1:18082524-18082546 ATGGAGTTGTATAGATAGAATGG - Intergenic
906995300 1:50787073-50787095 ATGTGGTTCTACAATGAAAATGG + Intronic
907084761 1:51661136-51661158 ATGTGGTTGTAGAGTTATAATGG + Intronic
908764465 1:67541850-67541872 AAGTAGTTGTATAATTACAATGG + Intergenic
909007039 1:70289285-70289307 ATGTATTTGAATAGTTAAAGAGG - Intronic
909418995 1:75441954-75441976 ATATATTTCTATACCTAAAATGG + Intronic
909884951 1:80929826-80929848 ATGTACTTTTATCTTTAAAATGG - Intergenic
910043106 1:82877668-82877690 ATGTAATTCTCTCGTTTAAAGGG - Intergenic
910991788 1:93064120-93064142 ATAAAGTTGTATAGGTAAAAAGG - Intergenic
912259972 1:108100957-108100979 GTGAAGATCTGTAGTTAAAATGG - Intergenic
912870323 1:113298416-113298438 ATGGAATTATAAAGTTAAAAGGG + Intergenic
916845997 1:168650766-168650788 ATATAGTTCTATACATGAAAGGG - Intergenic
918827477 1:189343993-189344015 ATGTAGTTCTTAAATTAATATGG + Intergenic
918910940 1:190568638-190568660 CTGTAGTTCTGTTTTTAAAAAGG + Intergenic
920883481 1:209901494-209901516 CTGTAATTCTATAAATAAAAGGG + Intergenic
922883094 1:228997342-228997364 ATGAAGTGCTATAGGTAAAAAGG + Intergenic
1063991466 10:11569078-11569100 TTGTAGTTCTTTATTTACAAAGG - Intronic
1063994843 10:11610235-11610257 GTGTAGTTCATTACTTAAAATGG - Intronic
1064953014 10:20875366-20875388 ATGTAGTTCCAGTCTTAAAAGGG - Intronic
1065576004 10:27118868-27118890 ATGTAATTATATAGTTAAACTGG - Intronic
1066798394 10:39153135-39153157 ATGGAGGCCTATGGTTAAAAAGG + Intergenic
1066803616 10:39218880-39218902 ATTGAGGTCTATGGTTAAAAAGG + Intergenic
1067673888 10:48352344-48352366 ATCTACATCTATACTTAAAAAGG - Intronic
1069965034 10:72107952-72107974 ATGAAGATCAACAGTTAAAAGGG - Intronic
1070018842 10:72563667-72563689 ATGCAGTTCAGTAGTTTAAAGGG - Intronic
1071068254 10:81662414-81662436 ACGTAGTTATAAAGTTCAAATGG - Intergenic
1071242640 10:83725041-83725063 ATCTATTTCCATAGCTAAAATGG - Intergenic
1072080483 10:92025104-92025126 ATGTAGTTCTATAGTTAAAAAGG - Intronic
1074759077 10:116652201-116652223 ATGTAATTGTATAGTTCTAAGGG + Intergenic
1074832263 10:117257210-117257232 AGATAGTTCTATATTTACAAAGG + Intronic
1075199904 10:120393983-120394005 ATGTAGTTTTAGATTTAGAAAGG + Intergenic
1075856010 10:125630870-125630892 ATGTAGCTCTGGAGTTAAAAAGG + Intronic
1075892740 10:125968032-125968054 ATATAATTTTATAGGTAAAATGG + Intronic
1078411719 11:11127062-11127084 ATGTATTTATATAGTTTTAAGGG + Intergenic
1079918196 11:26397489-26397511 ATGAAGTTCTCTATATAAAAAGG + Intronic
1079956442 11:26871883-26871905 ATGTATTTTTATAGTTTTAAGGG - Intergenic
1082132599 11:48508154-48508176 ATTTAGCTCTATAGCTAACAAGG - Intergenic
1082144658 11:48652301-48652323 ATGGAGTTCAATGGTGAAAAAGG + Intergenic
1082146184 11:48672504-48672526 ATGGAGGTCTATGGTGAAAAAGG + Intergenic
1082148654 11:48703531-48703553 ATTTAGGTCTATGGTGAAAAAGG - Intergenic
1082305946 11:50575216-50575238 ATAGAGGTCTATGGTTAAAAAGG - Intergenic
1082581748 11:54878813-54878835 ATGGAGGCCTACAGTTAAAAAGG - Intergenic
1082588858 11:54979806-54979828 ATGGAAGTCTATGGTTAAAAAGG + Intergenic
1082589923 11:54993857-54993879 ATTTAGTCCTATGGTGAAAAAGG + Intergenic
1082591107 11:55011335-55011357 ATGGAGGTCTATGGTAAAAAAGG - Intergenic
1082652897 11:55816420-55816442 AACTAGTTCTTTGGTTAAAAAGG - Intergenic
1084352600 11:68613405-68613427 TAGTAATACTATAGTTAAAATGG + Exonic
1084622807 11:70285009-70285031 ATGTATTTCTTTATTTAAGATGG + Intronic
1086727185 11:90201214-90201236 ATGTAGATTTAAAATTAAAAGGG - Exonic
1086899559 11:92351442-92351464 ATGAATTTTTATATTTAAAAAGG - Intergenic
1087167336 11:95018605-95018627 ATGTAGTTATAGAATTAAAAAGG - Intergenic
1087731714 11:101785745-101785767 ATGTATTTGTATAGTTTTAAGGG + Intronic
1088151006 11:106745226-106745248 ATGGCATTCTATATTTAAAAGGG + Intronic
1092997191 12:13961569-13961591 ATTTAGTTATTCAGTTAAAATGG - Intronic
1094209877 12:27877910-27877932 CTTAAGTTCTAGAGTTAAAATGG + Intergenic
1094274796 12:28660780-28660802 ATGTGTCTCTATATTTAAAATGG - Intergenic
1094408062 12:30139913-30139935 ATGTAATGCAATAGTTAAAAAGG + Intergenic
1094432463 12:30384821-30384843 ATAAAGTCCTAGAGTTAAAATGG - Intergenic
1094444630 12:30516284-30516306 ATGTTTTTTTATTGTTAAAAAGG + Intergenic
1094857821 12:34423036-34423058 GTGTAGGTCTATGGTGAAAAAGG - Intergenic
1094867923 12:34560915-34560937 ATGGAGTCCTATGGTGAAAAAGG - Intergenic
1094875267 12:34633975-34633997 ATTGAGGTCTATAGTGAAAAGGG + Intergenic
1094876878 12:34657817-34657839 ATTTAGGCCTATAGTTAAAAAGG + Intergenic
1095076595 12:37936080-37936102 ATTGAGTTCTATTGTGAAAAGGG - Intergenic
1097574108 12:61369961-61369983 TTTGAGTTCTATATTTAAAAAGG + Intergenic
1098812470 12:75113507-75113529 ATGTAGGTTTATATTTATAAAGG + Intronic
1099327679 12:81240426-81240448 ATGTATTGTTATATTTAAAATGG + Intronic
1099852615 12:88121515-88121537 ATTTAGTTCTTTATTTCAAATGG - Intronic
1101119978 12:101569075-101569097 CTGTATTTCTAAAGTAAAAATGG - Intronic
1102634485 12:114311270-114311292 ATGTACTTCACTAGTTACAAAGG + Intergenic
1103585508 12:121951226-121951248 ATGGAGTTCTATATTAAATAAGG - Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1105232769 13:18514487-18514509 ATAAAGTTCTACAGCTAAAAAGG + Intergenic
1105649130 13:22354904-22354926 ATTAAGTTGTACAGTTAAAAAGG + Intergenic
1105721676 13:23122707-23122729 ATGTAATTCTTCAGTGAAAATGG + Intergenic
1106534745 13:30629886-30629908 GTGTAGTTCTCTAGTTCATAGGG + Intronic
1107183592 13:37491324-37491346 ATTTAATTATATAGTTCAAATGG - Intergenic
1107847191 13:44527809-44527831 ATGTGTTTTTATATTTAAAATGG - Intronic
1108789652 13:53952256-53952278 ATGTATTTCTAGAGGAAAAATGG - Intergenic
1109814765 13:67566272-67566294 ATGTAGTACTGTAATTTAAAAGG - Intergenic
1109822011 13:67669355-67669377 ATATGGTTCTATAGCTAAAGAGG + Intergenic
1109982107 13:69922808-69922830 ACGTAGAACTGTAGTTAAAAAGG + Intronic
1110722592 13:78781165-78781187 CTTTAGTTTTAGAGTTAAAATGG + Intergenic
1110894170 13:80728384-80728406 ATTTATTTCCATAGTAAAAATGG - Intergenic
1111141189 13:84121213-84121235 ATCTAGTCATATATTTAAAAAGG - Intergenic
1111179737 13:84648301-84648323 ATGTAGTTTTTTTGTTAACATGG + Intergenic
1111520393 13:89394697-89394719 ATGTAGTTGTATAATAAATAAGG - Intergenic
1111666837 13:91279920-91279942 ATTAAGTTCTGGAGTTAAAATGG + Intergenic
1111941596 13:94614176-94614198 ATGAAGTCTTACAGTTAAAAAGG - Intronic
1112110053 13:96286335-96286357 ATGTAGGTCTATAGAGAAAGAGG - Intronic
1112453593 13:99535892-99535914 TTCAAGTTCTATAGTGAAAAAGG - Intronic
1112642853 13:101296584-101296606 TTTTAGTTCTATAATTAAAATGG - Intronic
1113425287 13:110202555-110202577 ATGTAAATCTATAAATAAAATGG + Intronic
1113872543 13:113568845-113568867 ATTTTGTTCTATTGTTAAATTGG + Intergenic
1114776100 14:25483424-25483446 ATGTAGTTCTTTAGTCACACAGG - Intergenic
1115425663 14:33256266-33256288 ATCAATTTCTATAGTCAAAATGG - Intronic
1116589448 14:46752181-46752203 ATGTATTTTTAAAGATAAAAGGG - Intergenic
1117311502 14:54528586-54528608 ATGTGGTTCTACAGTGACAAAGG + Intronic
1121752192 14:96366284-96366306 ATGCAATTCTATATTGAAAAAGG - Intronic
1122478160 14:102026559-102026581 ATGTAATCCTATAGAAAAAAAGG - Exonic
1124113636 15:26817989-26818011 AAGTACTTCTAGAATTAAAAAGG + Intronic
1126269289 15:46794428-46794450 AAGTAGTACTATTGTTAAGATGG + Intergenic
1126506876 15:49414999-49415021 ATGTAGCTCTATAATTAAGGTGG + Intronic
1127290149 15:57562743-57562765 TTGTGGCTCTATAGTCAAAAAGG + Intergenic
1128624895 15:69190645-69190667 ATGTGTTTTTATATTTAAAATGG + Intronic
1128651316 15:69415725-69415747 GATTAGTTCTATACTTAAAATGG - Intronic
1129532063 15:76275482-76275504 ATGTATTTTTATATTTAAAGTGG + Intronic
1131349771 15:91688617-91688639 ATGAAATTCTATACTTTAAATGG + Intergenic
1131891655 15:96978572-96978594 ATACAGTTCTATACATAAAATGG - Intergenic
1134819502 16:17235174-17235196 ATGTAGTTCTAGATTTCAGAGGG + Intronic
1135233781 16:20736284-20736306 CTGTAGTTCTATGCCTAAAATGG + Exonic
1137058506 16:35759944-35759966 ATGGAGGTCTGTAGTGAAAAAGG - Intergenic
1137076254 16:35966081-35966103 TTTGAGTTCTATAGTAAAAAAGG + Intergenic
1138879777 16:60998033-60998055 AAGTAGTTCTAAAGTTTATATGG - Intergenic
1143369847 17:6432403-6432425 AAGTAGACCTATAGATAAAAAGG + Intronic
1143806210 17:9429168-9429190 ATGTAATTATACAGTTTAAATGG - Intronic
1150175738 17:63053597-63053619 ATGCAGTTTCATAGTTTAAATGG + Intronic
1150422078 17:65046145-65046167 ATATAGTGCTATATTTAAAAAGG - Intronic
1153393734 18:4593197-4593219 ATGTATTTGTATAGTTTATAGGG - Intergenic
1153668692 18:7389973-7389995 AAGTTGTGCTATATTTAAAAGGG + Intergenic
1153899303 18:9602034-9602056 ATTCAGTTCTATAGGTAACAAGG - Intronic
1154410039 18:14134779-14134801 GGGTAATTCTATAATTAAAAGGG - Intergenic
1154520536 18:15223965-15223987 ATAAAGTTCTACAGCTAAAAAGG - Intergenic
1155285658 18:24286421-24286443 ATGTAGATATATAGATTAAATGG - Intronic
1155570552 18:27187470-27187492 ATATAGTTCTATGCTTAAAATGG + Intergenic
1156190740 18:34717427-34717449 CTGTATTTCTGTAGATAAAAGGG - Intronic
1156421445 18:36957834-36957856 ATTTAATTATATAGTTCAAAAGG - Intronic
1156794305 18:41023637-41023659 ATGTAGTTCTTTTGGTAAAAAGG + Intergenic
1156830894 18:41489694-41489716 ATTTAGTTATATTATTAAAAAGG - Intergenic
1158073314 18:53499094-53499116 ATCTATTTCTATTGTTTAAAGGG + Intronic
1158740648 18:60138296-60138318 ATGGAATTCTGTAGTTAAATAGG + Intergenic
1159334669 18:67046611-67046633 ATCTAATTCTATAGTTTAAATGG - Intergenic
1160374257 18:78399343-78399365 ATGTACTTTTAAAGTCAAAATGG + Intergenic
1163002815 19:14379349-14379371 ATATAGTTCAATTGTTCAAAGGG - Intergenic
1163136806 19:15317489-15317511 ATGTAGTTTTATACTTTACAGGG + Intronic
1163187674 19:15650431-15650453 ATGTAGATATATAGATTAAAAGG - Intronic
1164359659 19:27490444-27490466 ATCAAGATCTATGGTTAAAAAGG + Intergenic
1164366861 19:27594069-27594091 ATTGAGTTCTATGGTGAAAAAGG + Intergenic
1165457022 19:35918183-35918205 ATTTAGATCTATATTTTAAAAGG + Intergenic
1165479921 19:36056644-36056666 ATGTAGTTTAATAGCTCAAAGGG - Intronic
1168614958 19:57830152-57830174 ATGTAGTTCCCTAGGTAACAAGG - Intronic
926546969 2:14254279-14254301 ATGAAGTTCTTTAAATAAAAGGG - Intergenic
926742105 2:16120479-16120501 ATCTAGATGTATAGTGAAAATGG - Intergenic
926866761 2:17368292-17368314 ATGTATTTGTATAGTTTTAAGGG + Intergenic
928500754 2:31892348-31892370 ATATATTTCTGTAGTTTAAATGG - Intronic
929717419 2:44327125-44327147 ATGTAGCTCTTTAGAGAAAAAGG + Intronic
930398474 2:50851886-50851908 ATGACTTTCTGTAGTTAAAAAGG + Intronic
930544394 2:52748208-52748230 ATTTACTTCTATAATTAAAATGG + Intergenic
930906534 2:56575220-56575242 ATGTAATTCTATACTTGAGAAGG + Intergenic
931354542 2:61523859-61523881 ATGTAGTACTTTAGTTGAAATGG - Intronic
931764526 2:65443067-65443089 ATGTAGTACTAGAGTTCTAAAGG + Intergenic
931992586 2:67805628-67805650 ATGTACTTTTATATTTAAAGTGG - Intergenic
932017425 2:68045695-68045717 AAGTAGTTCTAGAGATAAACAGG + Intronic
932281116 2:70492664-70492686 ATTCAGTTCAATAATTAAAAGGG - Intronic
932518646 2:72382625-72382647 AAGAAGTAATATAGTTAAAATGG - Intronic
935228383 2:101074773-101074795 ATGTAGTTTTACAGTTGAATTGG + Intronic
935255002 2:101302282-101302304 TTTTAGTGCTATAGTTAAAATGG + Intronic
936625371 2:114142623-114142645 CAGTAGGTCTATGGTTAAAACGG + Intergenic
936675188 2:114706611-114706633 ATGTGGTTCTAGATTTAGAATGG - Intronic
938519890 2:132057740-132057762 ATAAAGTTCTACAGCTAAAAAGG - Intergenic
939895670 2:147788194-147788216 ATCTAGGTTTGTAGTTAAAAAGG - Intergenic
939929339 2:148213727-148213749 TTGTATTTATGTAGTTAAAAGGG - Intronic
940062013 2:149582208-149582230 ATTTTGCTCTTTAGTTAAAAGGG - Exonic
941026790 2:160464968-160464990 CTGTAGTTCCATAAATAAAATGG + Intronic
941664645 2:168232243-168232265 ATGTAGCTATAAAGTAAAAATGG + Intronic
941993435 2:171578720-171578742 ATGTATTTCTAAAATGAAAATGG + Intergenic
942473998 2:176295942-176295964 ATGTAGTTATGTTATTAAAATGG + Intronic
943138871 2:183952173-183952195 ATGAAGTTTTATCTTTAAAATGG + Intergenic
943920110 2:193696031-193696053 ATTTAATTCAATAGATAAAATGG - Intergenic
944725358 2:202465956-202465978 ATGTTGTGCAAAAGTTAAAAAGG - Intronic
945572832 2:211491535-211491557 ACGTAGTTTTATAATTAGAATGG - Intronic
946565267 2:220957344-220957366 ATGGAGTTTTATAGTGAAAAAGG + Intergenic
947406685 2:229785396-229785418 ATGTAGTTTTGTAGTTTTAAGGG - Intronic
947541012 2:230978141-230978163 ATGTAGTTAAAAAGTAAAAATGG - Intergenic
948929352 2:241121629-241121651 ATTTATGTCTATATTTAAAATGG - Intronic
1170295517 20:14820387-14820409 CTTTAGTTTTATAATTAAAAAGG + Intronic
1172934799 20:38612351-38612373 ATGTAGTTTTAAATTTAAATTGG + Intronic
1173048269 20:39533480-39533502 ATGTATTTATATTTTTAAAATGG + Intergenic
1173560031 20:43997155-43997177 ATGGAGATCGATAGTCAAAATGG + Intronic
1174081775 20:47974976-47974998 ATGTATCTCTTTATTTAAAAAGG - Intergenic
1174681094 20:52409205-52409227 ATGTAGTTCTTTAGGTGAGAGGG + Intergenic
1175617840 20:60417638-60417660 ATGTATTTCTACAGTTTAGAGGG + Intergenic
1176761457 21:10798560-10798582 TTGTAGTGCTATGGTGAAAAAGG + Intergenic
1176863024 21:14023631-14023653 GGGTAATTCTATAATTAAAAGGG + Intergenic
1177645747 21:23898331-23898353 AGGTAGTTTTGTAGATAAAAGGG - Intergenic
1177804846 21:25864746-25864768 ATGTTGTGCTATAGTTATACAGG - Intergenic
1179603996 21:42500171-42500193 TCATAGTTCTATAGTTAAGATGG - Intronic
1181332588 22:22105298-22105320 ATGTATTTGTATAGTTTTAAGGG - Intergenic
1183567863 22:38629326-38629348 GTGGAATTCTAAAGTTAAAATGG + Intronic
950888529 3:16382242-16382264 ATGTGGTCGTCTAGTTAAAAAGG - Intronic
950937617 3:16856996-16857018 ATGTAGTGCTATTATTTAAATGG - Intronic
951204056 3:19907325-19907347 ATGTAGCTCAATTCTTAAAATGG + Intronic
951488325 3:23239578-23239600 ATTTAGTTTTATAATAAAAAAGG + Intronic
953399173 3:42597843-42597865 ATGTAGTTTTATAGTAAATTTGG - Intronic
954718629 3:52540225-52540247 ATGGAGTTCTAGACTTAAATAGG - Intronic
956654765 3:71538200-71538222 ATTCAGTTCTATTGTTTAAAAGG - Intronic
957800431 3:85072192-85072214 ATGTAAATCTATACTTACAACGG + Intronic
960160342 3:114343661-114343683 ATGTACTTCCATTGTTAATATGG - Intronic
960691462 3:120350013-120350035 ATGTGCTTCTACAATTAAAACGG - Intergenic
961073368 3:123959179-123959201 ATATAGTTCTATATTTAATTTGG + Intronic
962192118 3:133321877-133321899 ATGTATTTCTATAGTTTTGAGGG - Intronic
963747392 3:149138678-149138700 CTGTAGCTCTCTACTTAAAAGGG - Intronic
964686462 3:159401351-159401373 ATGTAGTTCTAATGTAAACAAGG + Intronic
964926240 3:161962038-161962060 TTGTAGTTCTATGATTAAAGAGG + Intergenic
964950706 3:162288970-162288992 AAGTAGTTCTAGAGATAAAATGG + Intergenic
965241113 3:166199356-166199378 ATTTAGTGCTACAGTTATAAAGG + Intergenic
965788888 3:172366405-172366427 ATTTAGTTCTTGAGTAAAAAGGG + Intronic
970097729 4:12483976-12483998 AGGTTGTTATATAGTTATAAAGG - Intergenic
970829399 4:20319090-20319112 ATGTAATTATATACTTTAAAGGG + Intronic
970901586 4:21165737-21165759 ATATAGTTATATAGCTAATATGG + Intronic
970974430 4:22026942-22026964 CTGTGGTTCTATGGTTAAAATGG - Intergenic
971061975 4:22981986-22982008 ATGTATTTGTATAGTTTTAAGGG - Intergenic
971439431 4:26664415-26664437 ATTAGGTTCTATAATTAAAATGG - Intronic
971796540 4:31235892-31235914 ATATATTTCTATAGCAAAAAAGG - Intergenic
973611719 4:52641954-52641976 TTGTAGATCTATCGTTCAAAAGG + Intronic
973931671 4:55799356-55799378 ATCGAGTTATATACTTAAAATGG + Intergenic
976474794 4:85471804-85471826 ATGTATTATTATTGTTAAAATGG - Intergenic
977004384 4:91546218-91546240 ATGTAGGTCTATAGTTTACTTGG + Intronic
977180438 4:93867025-93867047 GTGTAGTTCTATTTGTAAAATGG - Intergenic
977485681 4:97641722-97641744 ATATAGTACTATAATAAAAAAGG + Intronic
978875644 4:113637346-113637368 AAATAGTTCTATATTCAAAATGG + Intronic
979169147 4:117577622-117577644 ATCTAGCTCTTTATTTAAAAGGG + Intergenic
980138545 4:128886858-128886880 CTTGAGTTCTATAGTAAAAAGGG - Intronic
980254826 4:130365511-130365533 ATGTAATTATATAATTTAAATGG + Intergenic
980996117 4:139781360-139781382 AGAGAGTTCTATAGTTTAAAAGG + Intronic
983139535 4:164132536-164132558 ATGCAGTTATTTAGTTAAGATGG + Intronic
983164192 4:164454434-164454456 AGGTAGTTATATAATTAGAAAGG + Intergenic
983542641 4:168929589-168929611 TTGTATTTCTATAATTTAAAGGG - Intronic
984174985 4:176406380-176406402 GAGTAAATCTATAGTTAAAATGG - Intergenic
984371134 4:178865948-178865970 ATGTATATCTGTAGTTAAAATGG + Intergenic
984442094 4:179784975-179784997 ATGTATTCTTATATTTAAAATGG + Intergenic
986745842 5:10744202-10744224 ATGTACATCTATAGCTAAGAAGG + Intronic
988310741 5:29554192-29554214 AGGTAGTTATATAATCAAAAAGG - Intergenic
989071480 5:37516375-37516397 ATATAGGTTTATAATTAAAATGG + Intronic
989234168 5:39125632-39125654 ATGTAATGCTATATTTTAAAAGG + Intronic
989525636 5:42450921-42450943 ATGTATTTCTATAGTTTTGAAGG + Intronic
989849204 5:46187253-46187275 ATTGAGTTCTATAGTAAAAAAGG + Intergenic
990102680 5:52212497-52212519 TTGTAGAACTATAGATAAAAAGG - Intergenic
990192714 5:53278448-53278470 TTGTAGTTTTATAGGTAAAGTGG + Intergenic
991362973 5:65840180-65840202 ATGTAGTTCAATAGTGCTAAGGG + Intronic
993365780 5:87032504-87032526 ATGTATTTGTATAGTTTTAAGGG + Intergenic
994701246 5:103138277-103138299 TTGTTGTTCTATAACTAAAAAGG - Intronic
994816531 5:104593618-104593640 ATGTAGATGGATAGTAAAAAAGG - Intergenic
995058104 5:107784578-107784600 ATAGATTTCTATAGTTAGAAAGG - Intergenic
995562430 5:113396999-113397021 ATGGAGTTTTAATGTTAAAAAGG + Intronic
996178498 5:120389683-120389705 ATATATTTCAATAGCTAAAAAGG - Intergenic
996182337 5:120434474-120434496 GTGTTGTTCTATTTTTAAAATGG - Intergenic
996406283 5:123107767-123107789 AGGTAGTTCTTTGTTTAAAAGGG + Intronic
997202765 5:132022672-132022694 ATGAAGTTATATTTTTAAAAAGG + Intergenic
998241342 5:140447968-140447990 CTGGAGTTCTATTATTAAAAAGG + Intronic
998708630 5:144794912-144794934 ATGTATTTGTATAGTTTTAAGGG + Intergenic
1000466601 5:161586437-161586459 ATTTACATCTATAGTTATAATGG - Intronic
1000533712 5:162455245-162455267 ATGTATATTTATAGTTAAATAGG + Intergenic
1001236956 5:170038220-170038242 ATGAAGTACTATAGGTAATATGG + Intronic
1002922582 6:1583017-1583039 ATGTAGTTTTAAAGTTAATATGG + Intergenic
1003295562 6:4823634-4823656 ATGGAATTGTATACTTAAAATGG - Intronic
1003810276 6:9772041-9772063 ATCTAGTGCTATAGCAAAAAGGG + Intronic
1003926945 6:10885045-10885067 ATGAAATACTATAATTAAAATGG - Intronic
1004101778 6:12619811-12619833 ATGTAGTACTATTTCTAAAAGGG - Intergenic
1004886727 6:20058482-20058504 ATTTAGTTTTATGTTTAAAAAGG + Intergenic
1005474463 6:26194111-26194133 ATGTATTTCTAATCTTAAAATGG - Intergenic
1005605845 6:27476541-27476563 ATGTCCTTCTATACTTAAAAAGG + Intergenic
1007042385 6:38734707-38734729 ATTCAGTCCTATATTTAAAAAGG - Intronic
1007228640 6:40332348-40332370 ATGTAGTTTTATATGTAAACTGG - Intergenic
1008354824 6:50539961-50539983 ATTTAATTCAATATTTAAAATGG - Intergenic
1009489012 6:64263959-64263981 ATGTAGGACTATATTTACAAAGG + Intronic
1009641274 6:66340269-66340291 ATTTTCTTTTATAGTTAAAAGGG + Intergenic
1009742998 6:67772032-67772054 ATCTAGATTTAAAGTTAAAATGG + Intergenic
1009868633 6:69429445-69429467 ATGTGGTTCTTTAGAAAAAAGGG + Intergenic
1010101723 6:72117623-72117645 ATGTATTTCTATAGTTTTGAGGG - Intronic
1012048673 6:94311140-94311162 ATGTAACTCTATATTTCAAATGG - Intergenic
1012965876 6:105672268-105672290 ATGTATTTCTATAGTTTTGAGGG - Intergenic
1014044835 6:116873757-116873779 ATGTGGTTATATAATTGAAAAGG + Intergenic
1014250038 6:119105775-119105797 ATGTATTTCTATTATTGAAAGGG - Intronic
1014466044 6:121758542-121758564 ATGTATTTCTATTATTTAAAGGG + Intergenic
1016567979 6:145479261-145479283 ATATATATATATAGTTAAAATGG - Intergenic
1016589961 6:145734234-145734256 ATGTAGATGTATATTTTAAATGG - Intronic
1017714933 6:157202840-157202862 ATATATTTCTATATATAAAATGG - Intronic
1018056795 6:160059113-160059135 ATGTTGTTTTGTAGCTAAAAAGG + Intronic
1021225601 7:18022210-18022232 ATATACCTTTATAGTTAAAAAGG - Intergenic
1021664418 7:22961314-22961336 ATCTAATTTTATAGTTATAATGG - Exonic
1021774554 7:24039721-24039743 ATCTACTACTACAGTTAAAAAGG - Intergenic
1022617105 7:31942911-31942933 ATGTGGTACTATTTTTAAAAAGG - Intronic
1022713562 7:32875985-32876007 ATTTAATTATATACTTAAAATGG + Intronic
1023758072 7:43438782-43438804 ATGTATTTCTTTAGGTAACAGGG + Intronic
1025583629 7:62752506-62752528 ATGTAGGCCTATGGTGAAAAAGG + Intergenic
1025583845 7:62755935-62755957 ATTGAGTTCTATGGTTAAAAAGG + Intergenic
1025587745 7:62813738-62813760 ATGGAGGCCTATAGTGAAAAAGG - Intergenic
1025589785 7:62843093-62843115 ATGGAGGCCTATAGTGAAAAAGG + Intergenic
1025590116 7:62848363-62848385 ATGGAGGCCTATGGTTAAAAAGG + Intergenic
1025593108 7:62888685-62888707 ATATAGGTCTATGGTGAAAAAGG + Intergenic
1025598761 7:62967569-62967591 ATGGAGGTCTATGGTGAAAAAGG + Intergenic
1025599779 7:62981660-62981682 ATGGAGGTCTATGGTTAAGAAGG + Intergenic
1028697701 7:93735331-93735353 ATGTATGTCTATAGCTTAAACGG - Intronic
1029892615 7:103946475-103946497 AAGTAGTTCTATAGTGACCATGG + Intronic
1031514456 7:122684874-122684896 ATGAAGTTCCAAAGTAAAAATGG + Intronic
1031561010 7:123238251-123238273 ATCAAAATCTATAGTTAAAAAGG - Intergenic
1032962511 7:137053313-137053335 ATGGAGTTGTACACTTAAAATGG - Intergenic
1033142902 7:138843493-138843515 ATAATTTTCTATAGTTAAAAAGG + Intronic
1033785874 7:144729055-144729077 ATGAAGTGCTGGAGTTAAAATGG - Intronic
1036965575 8:13293931-13293953 ATATAGTTCTGTAGCCAAAAAGG + Intronic
1037079398 8:14765274-14765296 TTGTAGTTCTATCATTGAAAAGG - Intronic
1037224354 8:16566888-16566910 TTGTAGATTTATAGTGAAAAAGG - Intronic
1039219824 8:35317814-35317836 AGGTAGTCCTACAGTGAAAATGG - Intronic
1039343790 8:36681508-36681530 ATGTTATTCTCTATTTAAAATGG + Intergenic
1039534175 8:38293211-38293233 ATGAAGTTCTAAAATTTAAATGG + Intronic
1040715837 8:50250977-50250999 ATGTAGGTTTAAAGTCAAAAAGG + Intronic
1041334686 8:56768237-56768259 ATGTGTTTTTATAGTTAAAATGG + Intergenic
1041767156 8:61430967-61430989 ATGCAGTTCTAATTTTAAAAAGG + Intronic
1043010988 8:74881279-74881301 ATGTATTTCTATAATAATAATGG + Intergenic
1044518922 8:93175437-93175459 AAGTGCTTCTGTAGTTAAAATGG + Intergenic
1045538054 8:103052918-103052940 ATGTTGTTCTGTAATCAAAATGG + Intronic
1046522849 8:115346990-115347012 AGGTATTTCTATAATTACAAAGG + Intergenic
1048083068 8:131149499-131149521 AAGCAGTGCTATAGTTAACATGG + Intergenic
1048120956 8:131581394-131581416 ATGTAGCCCTAGACTTAAAATGG + Intergenic
1048290701 8:133179324-133179346 CTTTACTTCTATAGGTAAAAAGG + Intergenic
1050704628 9:8383207-8383229 ATTTTGTTCTATGGCTAAAAGGG - Intronic
1052104220 9:24492450-24492472 ATGTTTTTCTATATTTACAAGGG - Intergenic
1052597646 9:30580817-30580839 ATATTGTTCTATAGTTAAAGAGG + Intergenic
1055212770 9:73817335-73817357 GAGTGGCTCTATAGTTAAAAGGG + Intergenic
1055906323 9:81297678-81297700 CTGTATTTCTATATATAAAATGG - Intergenic
1056556314 9:87692358-87692380 ATGTATCTTTATAGATAAAATGG + Intronic
1057643109 9:96847037-96847059 ATGTATTTTTATAGTTTTAAAGG - Intronic
1057842802 9:98500158-98500180 ATGTACTTCTATTTTTATAAAGG - Intronic
1058073350 9:100624541-100624563 ATGTAGTTCTTCAGTGATAAAGG - Intergenic
1058313914 9:103540200-103540222 ATTTAGTTCTATAACTAAACTGG + Intergenic
1058913462 9:109542414-109542436 TTGTATTTCAATAGTTAATAAGG - Intergenic
1059000801 9:110346886-110346908 ATGTGATTCTATAGATAAGAGGG + Intergenic
1059873092 9:118600326-118600348 GTGGAGTTTTATAGTAAAAATGG + Intergenic
1203402117 Un_KI270519v1:117492-117514 ATGGAGTGCTATGGTGAAAAAGG + Intergenic
1203402950 Un_KI270519v1:132603-132625 TTTGAGTTCTATAGTGAAAAAGG - Intergenic
1186004201 X:5050237-5050259 TTGTTGTTTTATAGGTAAAATGG - Intergenic
1189131079 X:38498642-38498664 AGGTAGCTCTGAAGTTAAAATGG - Intronic
1189442586 X:41050307-41050329 ATGTAGTTCTTAAGTTTATATGG + Intergenic
1190472563 X:50797607-50797629 ATGTAGTTATGTGGTTTAAAAGG - Intronic
1191268980 X:58437326-58437348 ATTTAGGTCTATGGTGAAAAAGG - Intergenic
1191575376 X:62698597-62698619 ATGGAGTCCTATATTGAAAAAGG - Intergenic
1191781173 X:64867332-64867354 ATGTAATTTTACACTTAAAAAGG - Intergenic
1191787413 X:64931644-64931666 ATGTATTTCTATAGTTTTGAGGG + Intronic
1192229184 X:69253108-69253130 ATTGAGTTATATAGTTTAAATGG + Intergenic
1195211979 X:102659269-102659291 ATGTATTTTTACATTTAAAAAGG + Intergenic
1196347302 X:114678818-114678840 ATGTAGTTACATAATAAAAATGG - Intronic
1196621189 X:117826270-117826292 ATGTATTTGTATAGTTTTAAGGG + Intergenic
1196672745 X:118386687-118386709 ACGTACTTTTATAGCTAAAAAGG - Intronic
1197017663 X:121647105-121647127 ATGTGGTTTTATAGAGAAAACGG + Intergenic
1197310475 X:124899202-124899224 ATGTAGTACTTTAGGTAACAAGG - Intronic
1197390294 X:125855192-125855214 AAGAATTTCTATTGTTAAAATGG - Intergenic
1198668109 X:139046612-139046634 TTTTAGATCTATAGTGAAAAGGG - Intronic
1198923413 X:141757273-141757295 ATTTATTTCTATAGATAAAGAGG - Intergenic
1200310986 X:155077094-155077116 ATGCAATTCTATAGTTGAAGGGG + Intronic
1200527045 Y:4286564-4286586 ATGTTGTTCTGGAATTAAAATGG + Intergenic
1201391832 Y:13506046-13506068 ATGTATTTCTATAGTTTTGAGGG - Intergenic
1202037295 Y:20647949-20647971 ATGTACTTGGAGAGTTAAAAAGG - Intergenic
1202278532 Y:23150889-23150911 ATGTAGTTCTATAGATGTTATGG + Intronic
1202278687 Y:23153264-23153286 ATGTAGTTCTATAGATGTTATGG + Intronic
1202286051 Y:23248345-23248367 ATGTAGTTCTATAGATGTTATGG - Intronic
1202286516 Y:23255500-23255522 ATGTAGTTCTATAGATGTTATGG - Intronic
1202286671 Y:23257877-23257899 ATGTAGTTCTATAGATGTTATGG - Intronic
1202431356 Y:24782228-24782250 ATGTAGTTCTATAGATGTTATGG + Intronic
1202431511 Y:24784604-24784626 ATGTAGTTCTATAGATGTTATGG + Intronic
1202431814 Y:24789361-24789383 ATGTAGTTCTATAGATGTTATGG + Intronic
1202432117 Y:24794117-24794139 ATGTAGTTCTATAGATGTTATGG + Intronic
1202438151 Y:24868801-24868823 ATGTAGTTCTATAGATGTTATGG - Intronic
1202438454 Y:24873558-24873580 ATGTAGTTCTATAGATGTTATGG - Intronic
1202438610 Y:24875934-24875956 ATGTAGTTCTATAGATGTTATGG - Intronic