ID: 1072084983

View in Genome Browser
Species Human (GRCh38)
Location 10:92070020-92070042
Sequence TGGGACACATTTGGAAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072084974_1072084983 18 Left 1072084974 10:92069979-92070001 CCCTGTCCGAAACCCTCTGTAGA 0: 1
1: 0
2: 0
3: 5
4: 53
Right 1072084983 10:92070020-92070042 TGGGACACATTTGGAAAAAAAGG No data
1072084976_1072084983 12 Left 1072084976 10:92069985-92070007 CCGAAACCCTCTGTAGATATAAA 0: 1
1: 0
2: 0
3: 23
4: 222
Right 1072084983 10:92070020-92070042 TGGGACACATTTGGAAAAAAAGG No data
1072084973_1072084983 23 Left 1072084973 10:92069974-92069996 CCTTGCCCTGTCCGAAACCCTCT 0: 1
1: 0
2: 0
3: 12
4: 206
Right 1072084983 10:92070020-92070042 TGGGACACATTTGGAAAAAAAGG No data
1072084975_1072084983 17 Left 1072084975 10:92069980-92070002 CCTGTCCGAAACCCTCTGTAGAT 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1072084983 10:92070020-92070042 TGGGACACATTTGGAAAAAAAGG No data
1072084978_1072084983 5 Left 1072084978 10:92069992-92070014 CCTCTGTAGATATAAAATACATG 0: 1
1: 0
2: 1
3: 21
4: 265
Right 1072084983 10:92070020-92070042 TGGGACACATTTGGAAAAAAAGG No data
1072084977_1072084983 6 Left 1072084977 10:92069991-92070013 CCCTCTGTAGATATAAAATACAT 0: 1
1: 0
2: 0
3: 52
4: 472
Right 1072084983 10:92070020-92070042 TGGGACACATTTGGAAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072084983 Original CRISPR TGGGACACATTTGGAAAAAA AGG Intronic
No off target data available for this crispr