ID: 1072093446

View in Genome Browser
Species Human (GRCh38)
Location 10:92152495-92152517
Sequence GTTTAAAAGGGGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 0, 2: 7, 3: 35, 4: 452}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072093446_1072093452 26 Left 1072093446 10:92152495-92152517 CCTTCCACCTTCCCCTTTTAAAC 0: 1
1: 0
2: 7
3: 35
4: 452
Right 1072093452 10:92152544-92152566 ATTCCCTTTAAAATATTCCCAGG No data
1072093446_1072093453 27 Left 1072093446 10:92152495-92152517 CCTTCCACCTTCCCCTTTTAAAC 0: 1
1: 0
2: 7
3: 35
4: 452
Right 1072093453 10:92152545-92152567 TTCCCTTTAAAATATTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072093446 Original CRISPR GTTTAAAAGGGGAAGGTGGA AGG (reversed) Intronic
900233828 1:1576887-1576909 GTTTAAAAGGGGAAAATACAAGG + Intergenic
900337940 1:2174071-2174093 TTTTCAAAGGTGCAGGTGGAGGG + Intronic
901631500 1:10650337-10650359 GTTTAAAAGGGGATGGGGGAGGG - Intronic
902665522 1:17935059-17935081 TTTTAAAAAGGGAAGTGGGAGGG - Intergenic
903767231 1:25742623-25742645 GGTTAAATGGGGTAGGTTGATGG - Intronic
904087196 1:27917146-27917168 TTTTTAAAGAGGAAGGAGGAAGG - Intergenic
904712694 1:32442698-32442720 GTTTAAAAGTAGAAGGTGGCTGG + Intergenic
904999062 1:34653868-34653890 GTCTAAAGAGGAAAGGTGGACGG + Intergenic
905959371 1:42030910-42030932 GTTTTAAAAGGGAGGGTCGAAGG + Intronic
906896173 1:49774476-49774498 CTTTATATGGGGCAGGTGGAGGG + Intronic
907775468 1:57510148-57510170 GTTAAAAATGTGAATGTGGAAGG - Intronic
909089454 1:71207217-71207239 GTTTGAAAGGGGAAGCAGAAGGG + Intergenic
909752889 1:79185791-79185813 GTCTTAAAGGGGAAAGAGGAGGG - Intergenic
909831472 1:80196680-80196702 GTGGGAAAAGGGAAGGTGGATGG + Intergenic
910457695 1:87414940-87414962 CTTTGAGAGGCGAAGGTGGATGG + Intergenic
910655495 1:89614278-89614300 GTTTAAGAGGAACAGGTGGAAGG - Intergenic
911584059 1:99669810-99669832 ATTAAAAAGGAGAAGGAGGAGGG + Intronic
912626019 1:111204769-111204791 GTTGCAAAGGGAGAGGTGGAGGG - Intronic
913069485 1:115286033-115286055 GTGTAGAAGGGGCAGGGGGAGGG + Exonic
913323714 1:117607781-117607803 GTGGAAAAGGGGGAGGGGGATGG + Intronic
913551646 1:119922600-119922622 GTGTAAAGGGGAAAGGTGGCGGG - Intronic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915070817 1:153264544-153264566 GTAAAATAGTGGAAGGTGGAAGG - Intergenic
915103626 1:153518251-153518273 CTTCAAAAGGGCCAGGTGGATGG + Intergenic
915269387 1:154742930-154742952 GATTAAAAGGAGAAGCTGGGAGG - Intronic
916555165 1:165888530-165888552 GTTTAAGAGGCCAAGGTGGGTGG - Intronic
916831586 1:168497768-168497790 GGTTCAGAGGGAAAGGTGGAAGG + Intergenic
917106489 1:171497710-171497732 CTTTGAAAGGCGAAGGTGGGAGG - Intronic
917856292 1:179102932-179102954 GGTTTACAGGGGGAGGTGGATGG - Exonic
918093744 1:181318026-181318048 TTTTAAAAGGGGAAAGGGGTGGG - Intergenic
919635895 1:200003262-200003284 GTGTAAAAGTGGAAGGCGAAAGG - Intergenic
920187061 1:204166345-204166367 GTATAAAAGGGGAAGGGCTAAGG - Intergenic
920784450 1:209027429-209027451 TTTTTGAAGGGGAAGGTGGGGGG + Intergenic
921106606 1:211987051-211987073 CTTTGAAAGGGCAAGGTGGGTGG + Intronic
921176766 1:212602187-212602209 GCTGAAAAGGGGATGGTGTAGGG - Intronic
921728745 1:218553296-218553318 GTTCCAAAGGGCAAAGTGGAAGG - Intergenic
921809637 1:219497907-219497929 GTTTAAAGTGGGATGGTGGATGG - Intergenic
922108675 1:222535711-222535733 GTTTAGAAGAGGAAGGTAGGGGG - Intronic
922809008 1:228405848-228405870 GGCTAAGAGAGGAAGGTGGAAGG - Intronic
922893100 1:229076791-229076813 GTGTAGAAGGGGAAGGAGGGAGG + Intergenic
924907031 1:248466442-248466464 ATTTAAAAATGGCAGGTGGAGGG - Intergenic
924917080 1:248581696-248581718 GTTTAAAAATCGCAGGTGGAGGG + Intergenic
1062953341 10:1522352-1522374 CTCTAAGAGGGGGAGGTGGAAGG + Intronic
1063228138 10:4035177-4035199 ATTTAAAAGGGAAAAGTGGGAGG - Intergenic
1064204329 10:13310470-13310492 TTTAAAAAGGGTAAGGTGGCCGG - Intergenic
1064313227 10:14230778-14230800 GCTTGAAGGTGGAAGGTGGAAGG - Intronic
1065367326 10:24949377-24949399 TTTAAAAAGGGGCAGGTGGCTGG - Intronic
1065984066 10:30931950-30931972 ATTTATAAGGAGAAGGTAGAGGG + Intronic
1066339165 10:34512676-34512698 TTTTAAAAAAGGAACGTGGAGGG - Intronic
1067316303 10:45167498-45167520 TTTAAAAAGGTGAAGGAGGAGGG - Intergenic
1070330412 10:75412638-75412660 TTTCAAATGAGGAAGGTGGAGGG - Intergenic
1071690133 10:87809469-87809491 GTAAAAGAGGTGAAGGTGGAAGG + Intronic
1071713606 10:88073793-88073815 GGCTACAAGGGGAAGGTGGGGGG - Intergenic
1072093446 10:92152495-92152517 GTTTAAAAGGGGAAGGTGGAAGG - Intronic
1072748202 10:97957056-97957078 CTTTAAGAGGCCAAGGTGGAAGG - Intronic
1073185647 10:101613753-101613775 GCTCAAAGGGGAAAGGTGGAAGG - Intronic
1073734522 10:106330558-106330580 TTTTGGGAGGGGAAGGTGGATGG + Intergenic
1073967467 10:109007812-109007834 TTTTAAGAGGGAAATGTGGAAGG + Intergenic
1074394937 10:113089737-113089759 GTTTACAAGGAGAGGGTGGAGGG + Intronic
1074416322 10:113270015-113270037 TTTTAAAAAAGGAAGTTGGAAGG + Intergenic
1074775053 10:116761723-116761745 ATCTAAAACGTGAAGGTGGAAGG + Intergenic
1074834088 10:117272528-117272550 GTTTAAATGGGGAAAGAGGAGGG - Intronic
1075489797 10:122856874-122856896 GTTTAAAGGTGGGAAGTGGAGGG - Intronic
1076088128 10:127653785-127653807 GTTTGAAATGGGAATGAGGATGG - Intergenic
1076449177 10:130544481-130544503 GTTTAAAAGGAGAAGGTCAAAGG - Intergenic
1077477269 11:2796445-2796467 GTATAAAGGCTGAAGGTGGAAGG - Intronic
1078617251 11:12877741-12877763 GGAGAAAAGGGGAAGGAGGAAGG - Intronic
1079371612 11:19858217-19858239 GTTTACCAGGGGCTGGTGGATGG - Intronic
1079483472 11:20909156-20909178 GGTTAACAGGGGATGGTGGCGGG + Intronic
1081110910 11:39132059-39132081 GTTTTAAAGGGGATGGTGGAAGG - Intergenic
1082021435 11:47536887-47536909 GCTTGAAAGGGGAAGTAGGAAGG + Intronic
1083007097 11:59356753-59356775 GACTCAAAGGGTAAGGTGGAAGG - Intergenic
1083111258 11:60410100-60410122 GTTTGGAAGGCCAAGGTGGAAGG - Intronic
1083129476 11:60611003-60611025 ACTTAGGAGGGGAAGGTGGAAGG + Intergenic
1083426385 11:62589357-62589379 GTATAAGAGAGGAAGGTGAAAGG - Intronic
1083537941 11:63489310-63489332 GATGAAAAGGGAAAGGAGGAAGG - Intronic
1083608574 11:63993850-63993872 GTTTCAAAGAGGAAGCTGGCCGG + Intronic
1083818794 11:65154175-65154197 GTTTGAGAGGCCAAGGTGGAAGG + Intergenic
1084288724 11:68148123-68148145 GTTTAAAAGGGGATGATAGCTGG - Intergenic
1084525220 11:69693287-69693309 GTTTAGGAGGTCAAGGTGGAAGG + Intergenic
1084992455 11:72940166-72940188 GTTTAAAAGGCTAAGGATGATGG - Intronic
1086460781 11:87003556-87003578 CTTTGAAAGGCCAAGGTGGAAGG - Intergenic
1086536164 11:87849315-87849337 GTTTAAAAGTAGAAGGATGAGGG - Intergenic
1087429785 11:98038365-98038387 GTGCACAAGGGGAAGGGGGAAGG + Intergenic
1087642579 11:100771365-100771387 CTTTAAAAGGTGGGGGTGGAGGG - Intronic
1087698326 11:101406939-101406961 GCTTAAAAGGGGAGGGGGGCTGG + Intergenic
1088588012 11:111377072-111377094 TTTTTAAAGGGGATGCTGGAGGG - Intronic
1089089665 11:115860442-115860464 GTTTTAAAAGGGATGGAGGAAGG + Intergenic
1089319173 11:117613392-117613414 GCTTAAAGGGGAAAGGTGAAGGG + Intronic
1089321519 11:117629751-117629773 CTTTAAGAGGCCAAGGTGGAAGG + Intronic
1090868992 11:130726309-130726331 GCGTAAAAGGGGAGTGTGGAGGG + Intergenic
1090910965 11:131118934-131118956 CTTTGAGAGGGCAAGGTGGAAGG - Intergenic
1091440897 12:511347-511369 GGTTGAAGGTGGAAGGTGGAAGG - Intronic
1091441286 12:512953-512975 GGTGGAAAGTGGAAGGTGGAAGG - Intronic
1091725758 12:2845504-2845526 CTTGGAAAGGGGGAGGTGGAGGG + Intronic
1092034005 12:5315006-5315028 TTTAAAAAGGGGAAAGAGGAAGG - Intergenic
1092439925 12:8491619-8491641 CTATAAAAGGGGAAGCTGGTTGG - Intergenic
1093021972 12:14212375-14212397 GTAGGAAAGGGGAAGGTTGAAGG + Intergenic
1093278502 12:17159873-17159895 GTTGAAAGGGGGAATGTGAAGGG - Intergenic
1093417189 12:18933449-18933471 CTTTAAAAGGGTAAGGCGGAGGG - Intergenic
1094080442 12:26528856-26528878 GTTGTAAAGGGGAAGATGAAAGG - Intronic
1094188263 12:27668385-27668407 ATTAAAAAGGGGGAGCTGGAAGG + Intronic
1096161592 12:49382946-49382968 GTTTGAAAGGCCAAGGTGGGTGG - Intronic
1097085498 12:56465135-56465157 GTATAAAAGGAGAGGGTGGTTGG - Intronic
1097251648 12:57636467-57636489 GTGTTAAAGGGTAAAGTGGAAGG + Intergenic
1097309062 12:58098877-58098899 GTTTATAAAGGGAAGCAGGAGGG - Intergenic
1099201786 12:79686775-79686797 GTTTAAAAGGGGGAGATGATTGG - Intronic
1099930353 12:89067118-89067140 GTTGAAAAGTGGAAAGAGGATGG + Intergenic
1101249908 12:102922490-102922512 GTTTAAAAAGGCAAGGTTTAGGG - Intronic
1101840113 12:108322009-108322031 GTTTAAAAGGAAGAGGTTGAGGG + Intronic
1102427301 12:112854010-112854032 CTGTAAAATGGGAAGTTGGATGG + Intronic
1102763287 12:115408290-115408312 GTTTCTGAGGGGAAGGTGGAAGG + Intergenic
1103173090 12:118838778-118838800 GGGAAAAGGGGGAAGGTGGAAGG - Intergenic
1103974227 12:124691728-124691750 CTTTAAAAGGTGAAAGTGGGTGG - Intergenic
1103996780 12:124835150-124835172 GTGGAAAAGGGGAAAGTGTATGG + Intronic
1104888528 12:132126824-132126846 GCTTAAAAGGGGGAGGTGCAAGG - Intronic
1105669724 13:22599457-22599479 TTTCAAAAGAGGAAGGTGGCTGG - Intergenic
1106055306 13:26231518-26231540 GTCCAAAAGTGAAAGGTGGAAGG + Intergenic
1106194371 13:27480710-27480732 GTTTAGAAGGTCAAGGTCGAGGG - Intergenic
1107317699 13:39151262-39151284 ATGTAAAAGGGAAAGGTGGGGGG + Intergenic
1108437346 13:50413665-50413687 GGAAAGAAGGGGAAGGTGGAGGG + Intronic
1110375013 13:74783512-74783534 CTTTGAAAGGCCAAGGTGGAAGG + Intergenic
1110835289 13:80075562-80075584 CTTTAAAAGGCCAAGGTGGGTGG - Intergenic
1110874070 13:80488148-80488170 GTTCAAAATGGAAAGGTGGCAGG - Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1111742576 13:92222246-92222268 GTTAAAAAGGGGAAGATGGGAGG + Intronic
1112427332 13:99315040-99315062 GGTTAAAAGGGGAGGGAGGAAGG - Intronic
1112495165 13:99898351-99898373 GTTAAAAAGGGGCAGGGGGATGG + Intergenic
1112834493 13:103497633-103497655 CTTTATAAGAGGGAGGTGGAAGG - Intergenic
1113075908 13:106467962-106467984 CTGTAAAAGGGAAAGGTTGAAGG - Intergenic
1113456966 13:110456194-110456216 GTTTACAAGGGGAAGGTGGTGGG + Intronic
1114408930 14:22482488-22482510 GTTTAAAAGTGGAAATTTGAGGG - Intergenic
1114490896 14:23101332-23101354 GCTTACAAGGTGCAGGTGGAGGG - Intergenic
1114556473 14:23565210-23565232 GTTGAAAATGGAAAGTTGGAGGG + Intronic
1114770257 14:25422679-25422701 GTTGGAAAGTGAAAGGTGGAAGG - Intergenic
1115402255 14:32975321-32975343 GTCTAAAAAGGGAAGGAGGCAGG - Intronic
1116245735 14:42409089-42409111 TTATAATAGTGGAAGGTGGAAGG - Intergenic
1117299748 14:54412968-54412990 GTTTAAGAGGAGAAGTTGGCTGG - Intronic
1117399833 14:55348786-55348808 ATTTAAAAGTTGAAGGTGAAAGG + Intronic
1118168356 14:63360063-63360085 GTCTAAAAGGGGAAAATGGGAGG - Intergenic
1118510151 14:66463460-66463482 GGTAAAAAAGGGAAAGTGGAAGG - Intergenic
1118651693 14:67902996-67903018 GTTAAAAAGGGCATGGTGGTGGG - Intronic
1118678744 14:68217090-68217112 GTTTAGAGTGGGAAGGTGAAAGG - Intronic
1118762873 14:68891146-68891168 GTCTAGAAGGGGAGGGTGAAAGG - Intronic
1119416051 14:74470160-74470182 TTTTAAAAAGGGAAGGTAGAAGG - Intergenic
1119909391 14:78335946-78335968 TTTTAAAATGGAAAGCTGGAAGG - Intronic
1120097910 14:80409830-80409852 GTTTAAGAGGAAAAGGAGGAAGG - Intergenic
1120453797 14:84705260-84705282 GATTATATGAGGAAGGTGGAAGG + Intergenic
1120717216 14:87852794-87852816 GTATAAAAGGAGAAGGGGCAAGG - Intronic
1121080403 14:91103335-91103357 GGCTAAAAGGAGAAGGGGGAAGG - Intronic
1122059022 14:99124412-99124434 GTGGAGAAGGGGAAGGTGCATGG - Intergenic
1123451728 15:20369563-20369585 ATTTAAAAGGAGAAGGTGTGAGG - Intergenic
1123959623 15:25383391-25383413 CTTTAGAAGGGCAAGGTGGGTGG + Intronic
1124016118 15:25877299-25877321 GTTTACAAGCGGAAGGAGGTAGG - Intergenic
1125133097 15:36307517-36307539 GTTTTCAATGGGAAGGTTGAGGG + Intergenic
1126634085 15:50765277-50765299 GTGGAAAAGAGGAGGGTGGAAGG + Intronic
1127094253 15:55497108-55497130 TCTTAATAGGGGAAGGGGGAGGG - Intronic
1127245725 15:57171945-57171967 GTTTAAATGTAGAAGGTGGCAGG + Intronic
1127351829 15:58160839-58160861 GTTTAGTTGGGGAAGGTGCAAGG + Intronic
1128074715 15:64818953-64818975 GCTTAAGATGGGAAGGTGGGTGG + Intronic
1128325624 15:66722300-66722322 GTTTCAAAGGGAAAGCAGGAGGG + Intronic
1128767046 15:70257666-70257688 TTTGAAAAGAGGAAGATGGAAGG - Intergenic
1129294681 15:74593449-74593471 GTCTAAAAGGGTTAGGTGAAGGG - Intronic
1129361144 15:75025155-75025177 ATTTAAGAGGGCAAGGTGGGAGG - Intronic
1130271468 15:82452152-82452174 GTTTAAAAAGGAAGGGTGGGTGG - Intergenic
1130463808 15:84179488-84179510 GTTTAAAAAGGAAGGGTGGGTGG - Intronic
1130488866 15:84415295-84415317 GTTTAAAAAGGAAGGGTGGGTGG + Intergenic
1130500458 15:84494053-84494075 GTTTAAAAAGGAAGGGTGGGTGG + Intergenic
1130885225 15:88087249-88087271 GCTAAAGAGTGGAAGGTGGAGGG + Intronic
1131648122 15:94367824-94367846 GTTTTAAAAGAGAAGGTGGGAGG - Intronic
1133553349 16:6881023-6881045 GCATAGGAGGGGAAGGTGGAGGG - Intronic
1133652883 16:7829601-7829623 CTTTAAAAGAGGAAGGTGGGTGG - Intergenic
1135935836 16:26779266-26779288 GTTTAAAAAAAGAAGGTGGGGGG + Intergenic
1136046328 16:27618032-27618054 GTTTAAAAGGGGATCTTGGTCGG - Intronic
1136254768 16:29030645-29030667 GGCTAAAAGGGCAAGGGGGAGGG - Intergenic
1136563575 16:31055986-31056008 GTTTCTAAGGGGACTGTGGAGGG + Intergenic
1137483978 16:48876458-48876480 TGTTAAAATGGGAAGGTGGCAGG - Intergenic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1137757437 16:50913864-50913886 CTTTAAAATGAGAAGGTGGAGGG + Intergenic
1138050871 16:53776010-53776032 GGGAAAAAGGGGATGGTGGAGGG + Intronic
1139621180 16:68144586-68144608 CTTTAGGAGGGCAAGGTGGATGG - Intronic
1139803602 16:69544609-69544631 GTTTCTAAGGGGAAGGAGAAAGG + Intergenic
1140946272 16:79770871-79770893 GTTGCAAAGGGAAAGGGGGAGGG - Intergenic
1141191065 16:81824925-81824947 CTTTAAAAGAGGAAGGTAGGAGG + Intronic
1142018839 16:87767184-87767206 ATTTTAAATGGGAAGGTGGAAGG - Intergenic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1145243245 17:21251851-21251873 TTTCAAGAAGGGAAGGTGGAGGG - Intronic
1145768842 17:27478244-27478266 GTATAAAAGGGGATGGTGTCAGG + Intronic
1146433975 17:32825534-32825556 ATTTGAGAGGCGAAGGTGGATGG - Intronic
1146451275 17:32976047-32976069 CTTTAAGAGGCTAAGGTGGAAGG - Intronic
1147210458 17:38870027-38870049 GTTTATTAGGGGAAGGAGGGCGG + Exonic
1147400173 17:40176232-40176254 GCTTGAAAGGGGAAAGTGGCTGG - Intergenic
1147464053 17:40597058-40597080 TTTTAAAAGGGGAATGTGTTCGG - Intergenic
1148989511 17:51653249-51653271 GTTTACAAGGGGCAGCTGAATGG + Intronic
1149417542 17:56475580-56475602 ATTTAAAAGGGTAAGGTAAAGGG - Intronic
1150128532 17:62653757-62653779 TGTGAAAAGGGGAAGGTGGCCGG + Intronic
1152072236 17:78139591-78139613 TTTTAAAAGGAGAATGTGGCCGG + Intronic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1152784098 17:82239118-82239140 GTTTTGAGGGGGAAGGTGGCGGG + Exonic
1153148574 18:2062511-2062533 GTTAAAAAGGGTAAAGTAGAAGG + Intergenic
1153960503 18:10136099-10136121 GCTTCAAAGGGAAAGGAGGATGG + Intergenic
1155492332 18:26411540-26411562 CTTTGAAAGGCCAAGGTGGAAGG - Intergenic
1156205556 18:34882296-34882318 TTTTGAAAAGGGAGGGTGGAAGG - Intronic
1156765509 18:40649885-40649907 GTTTTAATGAGGGAGGTGGAAGG + Intergenic
1156949791 18:42881104-42881126 GTTTAAAAGAGGTAGGAAGATGG - Intronic
1157564429 18:48670348-48670370 GTGTAATGGGGCAAGGTGGATGG + Intronic
1157725424 18:49960071-49960093 GTTTAAAGGGGGAGTGTGCAGGG - Intronic
1158705007 18:59784424-59784446 GTTTTAAAGGGGAAAGTGGATGG + Intergenic
1159317014 18:66788525-66788547 TTTTAAAAGGGGAATGAGGAAGG - Intergenic
1160017443 18:75155409-75155431 GTTTGAGAGGTGAAGGAGGAGGG + Intergenic
1163567653 19:18060978-18061000 CTTTAAAATGGGAAGGGGTATGG + Intronic
1163816312 19:19466642-19466664 GTTTAAAATGGGAAGATAAATGG + Intronic
1164504164 19:28845199-28845221 GTTGAAGAGGGGAAGGGGGTGGG - Intergenic
1164820435 19:31246591-31246613 GTTTAAAAAGGGACAGAGGAAGG + Intergenic
1165798760 19:38534948-38534970 GTATACAAGGGGAAGCTGCAAGG - Intronic
1166385617 19:42378909-42378931 TCTTAAAGGGGGAAGGGGGAAGG + Intergenic
1166413682 19:42576187-42576209 TTTTGAAAGGCCAAGGTGGAAGG + Intergenic
1166651729 19:44580311-44580333 GTCTTAAAGGGGAAGTTGCAGGG - Intergenic
1166674073 19:44728607-44728629 CTTTGCAAGGGCAAGGTGGATGG - Intergenic
1166838685 19:45683017-45683039 GTTTAAAAGGTGGAGGTGAGAGG + Exonic
1168564014 19:57407658-57407680 CTTTGAAAGGTGGAGGTGGAAGG - Intronic
925030027 2:643278-643300 GATACAAAGTGGAAGGTGGAGGG - Intergenic
926406799 2:12561850-12561872 GTGTAGAGAGGGAAGGTGGAGGG + Intergenic
926778314 2:16444113-16444135 ATTTAAAAGAGCAAGGAGGAAGG - Intergenic
927902780 2:26833296-26833318 GTTTGAAAGGCCAAGGTGGGAGG + Intergenic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
929809150 2:45174198-45174220 GGATGCAAGGGGAAGGTGGAGGG + Intergenic
930017213 2:46979177-46979199 TTTCAAGAGGGGAGGGTGGAGGG + Intronic
930660158 2:54045246-54045268 GTTTTTAAGGGGATCGTGGAGGG - Intronic
930733245 2:54748804-54748826 TTTTAAAAGGCCAAGGTGGGAGG - Intronic
931161116 2:59691600-59691622 GGTTAAAAGGGGATGGTGGAAGG + Intergenic
931300763 2:60975842-60975864 GTTTGAAACGGGGAGGAGGAGGG - Intronic
932199927 2:69816861-69816883 GATTAAAAGGGTATGGTGGGTGG - Intronic
932257684 2:70301618-70301640 GCGTAAGAGGGGAAGGTGGTGGG + Intronic
932557334 2:72836127-72836149 GTTTACTAGGGGCAGGTAGAAGG - Intergenic
932880856 2:75500733-75500755 GTTGAAAAGGGGAGGGAGGGAGG - Intronic
933073116 2:77887597-77887619 GTTTAAAGGGGTTAGGTGGATGG + Intergenic
933483500 2:82888031-82888053 GTTTGAAAGGCCAAGGTGGGCGG + Intergenic
934583809 2:95470743-95470765 CTTTAAAAGGAGACTGTGGATGG - Intergenic
934595643 2:95605971-95605993 CTTTAAAAGGAGACTGTGGATGG + Intergenic
934787133 2:97019509-97019531 TTTTAAAAGGAGACTGTGGATGG - Intergenic
935037703 2:99395334-99395356 GTCTCAAAGGGAAAGGAGGAGGG - Intronic
935461076 2:103335019-103335041 TATTAAAAGGCTAAGGTGGAAGG - Intergenic
936770368 2:115905670-115905692 GTTGAAAAGGGGGATGTGGTGGG - Intergenic
938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG + Intergenic
939433396 2:142141195-142141217 GTTTGAAAGGCCGAGGTGGATGG + Intergenic
939971694 2:148669431-148669453 CTTTGAAAGGGCAAGGTGGGAGG + Intronic
940112283 2:150168096-150168118 CCTTAGAAGGGGAAGGTGTAGGG + Intergenic
941059335 2:160827712-160827734 GACTAGAAGGGGTAGGTGGAGGG + Intergenic
942263596 2:174197681-174197703 GTTTAAAGGGTGAAGAGGGATGG + Intronic
942442975 2:176055225-176055247 CTTTAAAAAGAGAAGGTGGCAGG - Intergenic
942689393 2:178569486-178569508 GTTAAATGGGGAAAGGTGGATGG - Exonic
942833862 2:180268766-180268788 GTTTAAATGGGGAAAGTCCAAGG + Intergenic
944105365 2:196073830-196073852 GGTAAAGAGTGGAAGGTGGATGG - Intergenic
945515375 2:210757881-210757903 GTTTAAAAGGGAGAGAAGGAGGG - Intergenic
945588115 2:211692676-211692698 CTTTATAAGAGGAAGGTAGAGGG - Intronic
945814979 2:214593701-214593723 TTTTAAAAGGAGAATGAGGAAGG + Intergenic
945945050 2:215987582-215987604 TTTTAAAAGAAGAAAGTGGAAGG + Intronic
946245495 2:218384964-218384986 CTTTAAAAGGCTAAGGTGGGAGG - Intronic
946728714 2:222688052-222688074 TTTTTGAAGGGGGAGGTGGAAGG - Intronic
947621033 2:231591232-231591254 CTTTAAAAGGCCAAGGTGGGAGG - Intergenic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948242855 2:236452830-236452852 TTTTAAAAAAGGAAGTTGGATGG - Intronic
948341681 2:237257790-237257812 GTTTAAAATGGGGATGTGGAGGG - Intergenic
1169338540 20:4777313-4777335 TTTTGAAAGGGTAAGGTGGGTGG - Intergenic
1169431368 20:5539280-5539302 CTTTCAGAGGGGAAGGTGGGTGG + Intergenic
1170059250 20:12242309-12242331 GTTTTAAATAGGAAGGTAGATGG - Intergenic
1171070482 20:22063279-22063301 GTGAAAAAAGTGAAGGTGGATGG - Intergenic
1171426947 20:25054940-25054962 GTTGTAAAGGTGAAAGTGGAAGG - Intronic
1173044347 20:39495098-39495120 TGTTAAGAGGGGAAGGTAGAAGG + Intergenic
1174053539 20:47783794-47783816 GCTTGAAAGGCGAAGGTGGTGGG - Intronic
1174599797 20:51715033-51715055 CTTTAAAAGGGGATAGGGGAAGG - Intronic
1175071302 20:56336209-56336231 CTTTAAAAGGCCAAGGTGGGTGG + Intergenic
1175096934 20:56548676-56548698 GTAAAGAAGGGGAAGGAGGATGG - Intergenic
1175603758 20:60295979-60296001 ATTTAAAATGGGAAGTTTGAGGG + Intergenic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1175825607 20:61934879-61934901 CTTGCAAAGGGGAAGATGGAAGG - Intronic
1176873705 21:14104951-14104973 GTTTAGAAAGGGGAGGTGGGGGG - Intergenic
1176918049 21:14649524-14649546 CTTTGAAAGGCCAAGGTGGATGG + Intronic
1178474505 21:32925444-32925466 TTTTAAAAGAGGAAGATGTATGG + Intergenic
1182122098 22:27794890-27794912 GATGAGAAGGGGAAGGGGGAGGG + Intronic
1182597337 22:31432183-31432205 ATTTAAAAGGCTAAGGTGGGAGG - Intronic
1182657643 22:31903244-31903266 GTTTAGGTGTGGAAGGTGGAGGG - Intronic
1182657666 22:31903314-31903336 GTTTACGTGTGGAAGGTGGAGGG - Intronic
1183516449 22:38269586-38269608 CTTTAGAAGGCCAAGGTGGAAGG + Intronic
1184812200 22:46843697-46843719 GTTTAAGAGGGGCAGGTGAGCGG + Intronic
1185271169 22:49929807-49929829 TTCTAAAAGGGGAACTTGGAAGG + Intergenic
949207099 3:1453362-1453384 GTTGAAAAAGGAAAGGAGGAAGG + Intergenic
949462646 3:4309614-4309636 GTGTGAAGGGGGAAGGTGGTGGG - Intronic
949716233 3:6934696-6934718 GTTTAAATGAGGACGGTGGCAGG + Intronic
949919432 3:8989488-8989510 GTTCAAAAGGAGAAGGAAGAAGG - Intronic
950290742 3:11782300-11782322 CTTTAAGAGGCCAAGGTGGATGG + Intergenic
950655136 3:14431852-14431874 GTTTAAAAGAGGAACAAGGAGGG + Intronic
950915435 3:16640286-16640308 TTTTAAAAGGGAAATATGGAGGG - Intronic
953309464 3:41863181-41863203 TTTGGAAAGGGGAAGGAGGAAGG - Intronic
953483476 3:43272658-43272680 ATAAAAAGGGGGAAGGTGGAAGG - Intergenic
953894913 3:46789763-46789785 TAATAAAAGGGGAAAGTGGATGG + Intronic
954284103 3:49606671-49606693 ATACAAAAGGGGGAGGTGGAAGG - Intronic
954582818 3:51712201-51712223 GTCTAAAAGGGGATGGCAGAGGG + Intronic
955087232 3:55715073-55715095 TTTTAAAAGATTAAGGTGGAAGG - Intronic
956012095 3:64842801-64842823 CTTTAGAAGGAAAAGGTGGAAGG + Intergenic
956689248 3:71860898-71860920 GTTTATATGGGGAATGTGGCAGG - Intergenic
957164318 3:76651727-76651749 AGTTAAAAGGGGGAGATGGAAGG - Intronic
958055400 3:88404541-88404563 GCTTAAAGAGGGAAGGTTGAAGG - Intergenic
958916144 3:100052712-100052734 TTTTACAAAGGCAAGGTGGAAGG + Intronic
959116557 3:102185035-102185057 GTTTAAAAGAGTAACGTGGCTGG - Intronic
960392163 3:117090722-117090744 CATTAAAGTGGGAAGGTGGAAGG + Intronic
960659657 3:120043850-120043872 GTTTAGATGGAGAAGGAGGAGGG - Intronic
962371177 3:134822006-134822028 GTTGAAAAGGAGGAGGAGGAAGG + Intronic
962628462 3:137250893-137250915 AGTTAAAAGGGGAAGTGGGAAGG + Intergenic
964036482 3:152205461-152205483 ATTAAAATGGGGAAGGAGGAGGG - Intergenic
964358208 3:155869925-155869947 GTTGCCAAGGGGTAGGTGGAGGG + Intergenic
964423576 3:156530063-156530085 GTTTAAGAGGGGAAGAAGGTTGG + Intronic
964578959 3:158209060-158209082 CCTTAAAAGGGGAATTTGGATGG + Intronic
964920748 3:161892567-161892589 GTGGAAAAGGGGAAGGAGAAAGG + Intergenic
966071747 3:175886227-175886249 GTTTAAAAGAGAAAACTGGAGGG - Intergenic
966185220 3:177221062-177221084 GTCTAGAAGAGGAAGGGGGAAGG - Intergenic
966274854 3:178153128-178153150 GTTTAGAAGGGTGAGGGGGAGGG - Intergenic
967094738 3:186168055-186168077 GTTGAAAAGAGGAAGGAAGAAGG + Intronic
967507200 3:190266016-190266038 ATAGAAAAGGGGAAGGAGGAGGG + Intergenic
967803938 3:193696890-193696912 GGTTAAACGGGGAAGCTGCAAGG - Exonic
968241214 3:197087958-197087980 GTGGAGAAGGGGAAGGTGGTTGG + Intronic
969232816 4:5843339-5843361 GCTACAAAGGGGAAGGTGGATGG - Intronic
969430586 4:7151543-7151565 GGTTATGAGGGGCAGGTGGAGGG + Intergenic
969492031 4:7504995-7505017 GTTTACCAGGAGGAGGTGGAGGG - Intronic
970290115 4:14562769-14562791 GAAGAAAAGGGTAAGGTGGATGG + Intergenic
970550880 4:17179652-17179674 GTTAAAAAGGTGAAGATGAAAGG - Intergenic
970573357 4:17404278-17404300 CTTTAAAAAGGGAAGGAAGAAGG + Intergenic
971162190 4:24144695-24144717 ATAGAAAAGGGGAAAGTGGAGGG - Intergenic
972152382 4:36109853-36109875 GCTCAAAAGGGGGAGGGGGAGGG - Intronic
972265511 4:37455192-37455214 GATTAAATGGGGAAGGGGGAGGG - Intronic
972592745 4:40503505-40503527 GTCAAAAAGGTGAAGGTGAAGGG + Intronic
972737041 4:41852707-41852729 GTGGAAAAGGGGAAGATGAATGG + Intergenic
974140728 4:57883207-57883229 TTTTTACAGGGGAGGGTGGATGG + Intergenic
974735814 4:65930299-65930321 GTTTAAAAGGGCAAAGTGCGTGG - Intergenic
977059483 4:92239545-92239567 GTTTATAAGGGGATCATGGAAGG - Intergenic
977839617 4:101686974-101686996 GAGCAAAAGGGGAACGTGGAAGG - Intronic
981052841 4:140328090-140328112 GTTTTAAATGGGAAGATGCAGGG + Intronic
981660119 4:147157158-147157180 GTTTACAAGGGCAAGATGGATGG + Intergenic
983006771 4:162493525-162493547 GTATAGAAGGGAAATGTGGATGG + Intergenic
983522219 4:168721669-168721691 GTTTAATGGAGGAAGGAGGATGG - Intronic
983570681 4:169204844-169204866 CTTCAAAAGGAGAAGGTGGCCGG - Intronic
983617048 4:169719167-169719189 GTTAAAAAAGGGAAAGTGGCTGG + Intronic
983913256 4:173264131-173264153 TTTGAAAAGGGAAGGGTGGAGGG - Intronic
984886576 4:184455191-184455213 GGTTAGAAGAAGAAGGTGGAGGG - Intronic
985382936 4:189414292-189414314 GTCTAAAAGAGGAAGGAAGAAGG + Intergenic
985896947 5:2754355-2754377 GTTTAATAGTGCAAGGTAGACGG - Intronic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986551826 5:8965018-8965040 ACTTGAAAGTGGAAGGTGGAAGG + Intergenic
987495652 5:18641020-18641042 ATTTAAAAGGGAGAGGAGGACGG + Intergenic
987664629 5:20921467-20921489 GTCTAAAAGGGGAATGTCAATGG + Intergenic
988758056 5:34280715-34280737 GTCTAAAAGGGGAATGTCAATGG - Intergenic
988923686 5:35967501-35967523 GTTTAAAAGGTGAAGGTTCAAGG + Intronic
989538995 5:42597079-42597101 GTTTAACAGTGGTGGGTGGAAGG + Intronic
989543114 5:42641124-42641146 GTCTATCAGGGGAAGGAGGAAGG - Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
990998267 5:61755517-61755539 TTGTAAAAGGGGAAGCTGAAGGG - Intergenic
991576973 5:68114650-68114672 GATAAACAAGGGAAGGTGGAAGG + Intergenic
994860820 5:105190585-105190607 GTTTAAAAGTGAAAGGTATATGG - Intergenic
994977653 5:106830498-106830520 GATTAAATCTGGAAGGTGGAAGG + Intergenic
995142842 5:108752216-108752238 GTAAAAAAAGGGAAGGAGGAAGG - Intronic
995331666 5:110954014-110954036 GTTTAAAGGTGAAAGATGGAAGG - Intergenic
995525437 5:113047039-113047061 GTTGAAGAGGGGCAGGTGGAGGG - Intronic
995532556 5:113106093-113106115 AGTGAACAGGGGAAGGTGGATGG - Intronic
996276185 5:121668725-121668747 GTTTTTAAGGGGATCGTGGAGGG + Intergenic
997871334 5:137507633-137507655 GTTGCAAAGGGGCAGGTGGAAGG - Intronic
998173994 5:139889643-139889665 GTTTGTAATGGGAAGGGGGAGGG - Intronic
999786684 5:154896816-154896838 GTTTAATAGAGGAAGCTGGCTGG + Intronic
1000440621 5:161259021-161259043 GGAGAAAAGGGGAAGGGGGACGG - Intergenic
1000632374 5:163605458-163605480 GTTTAAAAGGGGGATGTGGTGGG - Intergenic
1002355186 5:178622275-178622297 TTATATAAGGGGAAGGGGGAAGG - Intronic
1002884342 6:1280720-1280742 GTTTAAAGGGGGAATGAGGGAGG + Intergenic
1002934203 6:1657906-1657928 CTTTAAAAAGGGGAGGGGGATGG - Intronic
1003164601 6:3665267-3665289 GCTTATTAGGAGAAGGTGGAGGG - Intergenic
1003179631 6:3780643-3780665 GTCTAAAAGAGGCAGGTGGGAGG + Intergenic
1003827841 6:9972129-9972151 CTTTCAGAGGCGAAGGTGGATGG - Intronic
1004411984 6:15389622-15389644 GTTTTAAAGGGTGAGCTGGAAGG + Intronic
1004485073 6:16058704-16058726 GTTTTTAAGGGAAAGATGGAGGG - Intergenic
1004695184 6:18026693-18026715 GTTTAAAAGAGCATGGTGGCCGG - Intergenic
1005656272 6:27941450-27941472 GTATAACAGGGAAGGGTGGAAGG + Intergenic
1006210516 6:32389781-32389803 GTAGAAAACGTGAAGGTGGATGG + Intergenic
1009265100 6:61544544-61544566 GTTTAACTGGGGAAAGTGGTAGG + Intergenic
1009661569 6:66619082-66619104 GATAAAAAGGGGATGGTTGATGG + Intergenic
1010077101 6:71811539-71811561 CTTTAAGAGGCCAAGGTGGACGG + Intergenic
1010082367 6:71878760-71878782 CTTTGAAAGGCCAAGGTGGAAGG + Intergenic
1010529706 6:76952664-76952686 GTGTAAAAGGGGATGTGGGATGG + Intergenic
1011326557 6:86154603-86154625 GTATTAAAGGGGATGGTGAATGG + Intergenic
1011401972 6:86973158-86973180 ATTTAAAAGGAGAAGGTGGAGGG - Intronic
1011726825 6:90218278-90218300 GTTTAAAAGAAGAAGGTGTTGGG - Intronic
1012425054 6:99104907-99104929 GTTTAGGAGGCTAAGGTGGAAGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013787874 6:113802543-113802565 GTTTGAGAGGCCAAGGTGGATGG + Intergenic
1014496628 6:122132285-122132307 GTATAAAAGGGCATGGTGCAAGG - Intergenic
1014664825 6:124223940-124223962 GTTTAAAATGAGATGGTGCATGG + Intronic
1015212748 6:130716802-130716824 GGTTAATAGGGGAATGGGGAAGG + Intergenic
1018814424 6:167320430-167320452 GAAGAAAAGGGGAAGGAGGAAGG - Intergenic
1018888836 6:167966086-167966108 GTTTAAGAGGGGCAGGAAGAAGG - Intronic
1020598352 7:10241020-10241042 GATTAACAGGGAAAGGAGGAGGG - Intergenic
1021273996 7:18626460-18626482 GTTAAAATGGGGATGTTGGAGGG - Intronic
1021737948 7:23657457-23657479 GTTTAGAAGGAGAAGGAGTAGGG - Intergenic
1022051712 7:26680849-26680871 TGTTAAAAAGGGAAGGAGGAAGG + Intronic
1022239931 7:28500731-28500753 ATTTTAAGGGGGAAGCTGGAGGG + Intronic
1022575744 7:31495323-31495345 GTTTAAAAGGGGAAAGCAGCTGG + Intergenic
1022576308 7:31500531-31500553 ATTGAAAAGTGGAATGTGGAAGG - Intergenic
1023213591 7:37834479-37834501 CTTTAGGAGGGCAAGGTGGAAGG - Intronic
1024315659 7:48014285-48014307 GTCTAAAATCGGAAGGTAGAAGG + Intronic
1024377882 7:48659639-48659661 CATTAAAAGGGGAAGGAGTAAGG - Intergenic
1026024648 7:66734674-66734696 GTTTAGGAGGCCAAGGTGGATGG - Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1026638776 7:72106565-72106587 GAGAAAAAGAGGAAGGTGGAAGG + Intronic
1026649733 7:72205444-72205466 GTTTGAAAGGCCAAGGTGGGTGG - Intronic
1027628985 7:80579039-80579061 GTTTAAAAGGGGAAGAAAGAAGG + Intronic
1027682285 7:81235890-81235912 GTTCCAATGGGGAAAGTGGAAGG - Intergenic
1027879702 7:83818789-83818811 TTTTAAAAGGTGAAAGTAGAGGG + Intergenic
1028012131 7:85659357-85659379 GTTAAACAGGGCAAGGAGGAGGG - Intergenic
1029418864 7:100461618-100461640 GGTTGTTAGGGGAAGGTGGAGGG - Intronic
1029880799 7:103807608-103807630 GCTTGAGAGGGGAGGGTGGAAGG - Intronic
1030934649 7:115570455-115570477 TTTTAAAAAGGGGAGGGGGATGG - Intergenic
1031068876 7:117139961-117139983 GTTTAAAAGCTGAATGTGGCTGG - Intronic
1031273213 7:119681556-119681578 GTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1032155377 7:129463469-129463491 TTTTCAAAGGGGAAGATGGAAGG - Intronic
1033336908 7:140461550-140461572 GTTTAAACATGGGAGGTGGAGGG + Intronic
1033358445 7:140620337-140620359 GTTTAAAAGGGGTGGGGGGGGGG + Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034855762 7:154545153-154545175 GTTTAAAAGAGTAAAGTGTAAGG - Intronic
1036447679 8:8836676-8836698 GTTCAAAAAGGAAAAGTGGATGG - Intronic
1037200762 8:16249720-16249742 GTTTAAAAAGGGAAGTTGGAAGG + Intronic
1037247336 8:16850177-16850199 GCTTGAAATGGGGAGGTGGAGGG + Intergenic
1037295115 8:17391277-17391299 GTTTACAGGGGGAGGGTGGCAGG + Intronic
1037674130 8:21039696-21039718 ATTTGAAAGGGAAAGATGGATGG - Intergenic
1039367374 8:36944456-36944478 GTTTGAGTGGGGAGGGTGGAAGG + Intergenic
1039477192 8:37845381-37845403 GCTTGTTAGGGGAAGGTGGAGGG + Intronic
1039532153 8:38272452-38272474 GCTGAGAAGGGCAAGGTGGATGG - Exonic
1040407862 8:47125733-47125755 GATTAAAAGGGGCAGGGGGCAGG + Intergenic
1041532708 8:58889504-58889526 GGTGAAAATGGGAAGCTGGAAGG + Intronic
1042015972 8:64312036-64312058 GTTTAAAACAGGAAGATGGCAGG - Intergenic
1042089651 8:65144868-65144890 GTTGAAAAGAGGAAGAAGGAAGG - Intergenic
1042936985 8:74069531-74069553 GTTTAAAAGTGTTAGGTGGATGG - Intergenic
1043457084 8:80423287-80423309 ATTTAAGGGGAGAAGGTGGAGGG - Intergenic
1045308173 8:100977094-100977116 CTTTAAGAGGGAAAGGTGGGTGG + Intergenic
1045460928 8:102425260-102425282 GGATAAAAAGGGAAGGTGGCTGG + Intergenic
1046676466 8:117114329-117114351 GTTCAGAGGGGCAAGGTGGAAGG - Intronic
1048167619 8:132077338-132077360 GTCTAGAGGAGGAAGGTGGAGGG + Intronic
1048491537 8:134898179-134898201 CTTGAAATGTGGAAGGTGGAAGG - Intergenic
1048519791 8:135142857-135142879 GTTTGAAAGAGGAAGATGAAGGG + Intergenic
1048654521 8:136521211-136521233 TTTTAAAAGGGGCAGGGGGCAGG - Intergenic
1048884207 8:138896339-138896361 TTTTAAAAGGGGAAGGGTAAAGG + Intronic
1049033831 8:140059103-140059125 GTTGTAAAGGGGCAGGAGGAAGG - Intronic
1050027799 9:1353923-1353945 GTTTGAGAGGGGCAGGTAGAGGG + Intergenic
1050046474 9:1551794-1551816 GGTTAACAGGGTATGGTGGAGGG + Intergenic
1050195409 9:3078030-3078052 CTCAAAACGGGGAAGGTGGAAGG - Intergenic
1050301039 9:4259341-4259363 TATGTAAAGGGGAAGGTGGAAGG - Intronic
1050530853 9:6588111-6588133 GTTTAAAAGGGGGTGGGGGTGGG + Intronic
1050609594 9:7337640-7337662 TTTTTAAAGGAGAAGGTAGATGG + Intergenic
1052261151 9:26517738-26517760 GATTAAAAAGGGAATCTGGAGGG + Intergenic
1053447893 9:38166992-38167014 GTTGAAGAAGGGAAGGAGGAAGG - Intergenic
1054131406 9:61370203-61370225 GTTTGAGAGGGCGAGGTGGATGG + Intergenic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1056424461 9:86463218-86463240 GCTTAAACGTGGGAGGTGGAGGG - Intergenic
1056486297 9:87061561-87061583 ATTTTAAAGGAGAAGGTGAAAGG - Intergenic
1056844632 9:90026523-90026545 TTTTAAAAGGGAAATGTGGGTGG + Intergenic
1057642489 9:96837967-96837989 CTTTGAAAGGCCAAGGTGGACGG - Intronic
1058045759 9:100354938-100354960 GTAAAAAAGGGGAGAGTGGAAGG - Intergenic
1058986385 9:110212049-110212071 GTGTAAAAGGTGAAGGAGAAAGG - Intergenic
1059760592 9:117333798-117333820 GTTTAAAATGGGCAAATGGACGG - Intronic
1060185714 9:121562951-121562973 GGCTACAAGGGGAAGGTGGCCGG - Intergenic
1060335527 9:122718307-122718329 GCTGAAAAGGCAAAGGTGGAAGG + Intergenic
1185695105 X:2188202-2188224 ATTTATAAGGGAAAGCTGGATGG - Intergenic
1186514489 X:10156444-10156466 ATTTGAAAGGCGAGGGTGGAGGG + Intergenic
1186693395 X:12003771-12003793 TTTTTAAAGGGGAAAGTGAAAGG - Intergenic
1189330951 X:40144982-40145004 GATTAAAAGGGGCGGGGGGAGGG - Intronic
1189390341 X:40570957-40570979 GGTTAAAAGCGGAACGGGGAAGG + Intergenic
1189506881 X:41620195-41620217 TTTTAAAAGGGAATAGTGGAAGG + Intronic
1190182024 X:48200616-48200638 CTTTGAAAGGTCAAGGTGGACGG - Intronic
1190231218 X:48583479-48583501 GTTTAACAGGGGCAGGGGGCAGG - Intergenic
1190914877 X:54803936-54803958 GTTCACAAGGAGAAGGTGGGAGG + Intergenic
1192145333 X:68678362-68678384 GAGTAAAAAGGGAAGGAGGAAGG + Intronic
1192444429 X:71200002-71200024 GGTAAAAAGGGGAAGGGGGATGG - Intergenic
1193679996 X:84506861-84506883 TTTTAGAAGGGCAAGGTGTAAGG - Intergenic
1195261698 X:103138469-103138491 GATGAAATGGGGAAGGGGGAGGG - Intergenic
1195482495 X:105362250-105362272 CTTGAAAATGTGAAGGTGGATGG + Intronic
1195598704 X:106722131-106722153 GTTTGGAAGAGGAGGGTGGAAGG + Intronic
1195800903 X:108708758-108708780 TTTTCAAGGTGGAAGGTGGAAGG + Intergenic
1197217652 X:123881446-123881468 GTTTAAGAGTGAAAGGTGGAAGG - Intronic
1197677469 X:129346093-129346115 ATTGCAAAAGGGAAGGTGGATGG + Intergenic
1197759233 X:130015917-130015939 GTGAAAATGGAGAAGGTGGATGG + Exonic
1197807469 X:130411613-130411635 GTGTGAAAGGGGAAGGTGTGGGG + Intronic
1198218424 X:134578031-134578053 AATTACAAGGGGAAGGTGGCAGG + Intronic
1199270939 X:145881915-145881937 TCTTGAAAGGGGAATGTGGATGG + Intergenic
1199698860 X:150362285-150362307 GGTGAAAATGGGAAGGGGGATGG + Intronic
1199855054 X:151753125-151753147 GTCTAGAAAGGCAAGGTGGATGG + Intergenic
1200277412 X:154747555-154747577 CTTTAGAAGGCCAAGGTGGAAGG + Intronic
1200559101 Y:4677543-4677565 TATTAAAAAGGTAAGGTGGAAGG - Intergenic