ID: 1072094576

View in Genome Browser
Species Human (GRCh38)
Location 10:92164811-92164833
Sequence GGATTGTGCTGCTGAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072094576 Original CRISPR GGATTGTGCTGCTGAAAAAC AGG (reversed) Intronic
901581655 1:10249303-10249325 GGATTGTACTACTGAAAGACTGG - Intronic
902660653 1:17900127-17900149 GCATTGTGCTGGTAAAAAATAGG + Intergenic
910402383 1:86850203-86850225 GGATTTTGCTGCAGATGAACTGG - Intergenic
911109776 1:94170480-94170502 GGATTGGGATGCTGAAACACAGG + Intronic
914083311 1:144429745-144429767 GAAATGTGCTGCTGTAAGACTGG + Exonic
914189335 1:145395023-145395045 GAAATGTGCTGCTGTAAGACTGG + Exonic
914276387 1:146128164-146128186 GAAATGTGCTGCTGTAAGACTGG + Exonic
914366431 1:146983024-146983046 GAAATGTGCTGCTGTAAGACTGG - Exonic
914444503 1:147738616-147738638 AGATTGTGCTCCTGAACCACAGG - Intergenic
914486016 1:148110423-148110445 GAAATGTGCTGCTGTAAGACTGG + Exonic
914537431 1:148579119-148579141 GAAATGTGCTGCTGTAAGACTGG + Exonic
914628495 1:149486226-149486248 GAAATGTGCTGCTGTAAGACTGG - Intergenic
915802055 1:158804188-158804210 GGATTGTGCTGCAACAAAACAGG + Intergenic
918761775 1:188419605-188419627 GGATGGTGAAGCAGAAAAACAGG + Intergenic
919112991 1:193242888-193242910 TCATTGTGCTGCGGTAAAACTGG + Intronic
920188916 1:204179842-204179864 GGTTTGTGCTGCTGCGAAACAGG + Intergenic
920389785 1:205592223-205592245 GGAAGGTGCTGCTGAGAAACAGG - Exonic
920784017 1:209023105-209023127 GCCTTGAGCTGCAGAAAAACAGG + Intergenic
921206992 1:212857996-212858018 GGGTTGTGTTGCTGGAAAAAGGG - Intergenic
923950488 1:238946151-238946173 TTATTCTGATGCTGAAAAACAGG + Intergenic
924665353 1:246065347-246065369 TCAATGTGCTGCTGAAAAACTGG + Intronic
1063197484 10:3757221-3757243 GGCTTGTGCTGCAGAGATACTGG + Intergenic
1064855790 10:19766102-19766124 GGTGTGTTCTGCTGAAATACTGG - Intronic
1065088867 10:22209178-22209200 GGTTTCTTCTGCTCAAAAACTGG + Exonic
1068381560 10:56260365-56260387 GAATGGAGCTGCTGAAATACTGG - Intergenic
1068911004 10:62378221-62378243 GCACTGTGCTGTTGAAAAAAGGG + Intronic
1072094576 10:92164811-92164833 GGATTGTGCTGCTGAAAAACAGG - Intronic
1072985549 10:100136582-100136604 GGACTGTGCTCCTGATAAAAGGG + Intergenic
1073512992 10:104054039-104054061 GGATTGAGCAGCTGCAACACTGG + Intronic
1074184818 10:111091977-111091999 GGACTGTGCTCCTGAAGAAGTGG - Intergenic
1074455299 10:113590718-113590740 GGTCTGTGCTGCTGTGAAACTGG + Exonic
1077889319 11:6407321-6407343 GGATAGTACTGCTGAAGAGCTGG - Intronic
1078131276 11:8616189-8616211 GGCATGTGCTGCTGAAAGAATGG + Exonic
1078247887 11:9592660-9592682 GGATGCTGCTGCTTAAGAACTGG - Intronic
1078945018 11:16055891-16055913 GCATAGAGCTGCTGCAAAACAGG + Exonic
1079176094 11:18142475-18142497 GGATTCTTCTGCTGGAACACAGG - Intronic
1079179590 11:18178197-18178219 GGCTTGTACTGCTGGAACACAGG - Intronic
1079267842 11:18952078-18952100 GGCTTCTTCTGCTGAAACACAGG + Intergenic
1080953754 11:37067675-37067697 GGTATCTGCTGCTGAAAAACTGG - Intergenic
1082641219 11:55663814-55663836 GGAGTGGGCTACTGAAAAGCAGG + Intergenic
1088261827 11:107951334-107951356 GTAATGTCATGCTGAAAAACAGG + Intronic
1090465485 11:126929614-126929636 GGGTCTTGCTGCTGCAAAACTGG - Intronic
1095222071 12:39627577-39627599 GGATTGTGTTTCTGAAAATGAGG + Intronic
1095559193 12:43545373-43545395 GGACTGTGCAGCTGAAAAACAGG - Intronic
1097182912 12:57181072-57181094 GGCTTGGGCTGCTCAGAAACAGG - Intronic
1098263668 12:68697116-68697138 GGATTCTGCTGCTTTAAAAAAGG + Intronic
1098882594 12:75931553-75931575 GAATTGTGCTACTGATTAACTGG - Intergenic
1099578193 12:84406328-84406350 GGCTTCTGCTGCTGGAAAATTGG - Intergenic
1100126648 12:91435421-91435443 TGAGTGTGCTGCTTAATAACAGG - Intergenic
1104435229 12:128750611-128750633 TGTTTGTGATGCTGAAAAATGGG + Intergenic
1105939494 13:25134653-25134675 GGAGTGAGCTTCTGAAAAAAGGG - Intergenic
1106217585 13:27717006-27717028 GGCTTGTGCTGCTGACAGACTGG - Intergenic
1106526508 13:30545524-30545546 GGATTCTTTTGCAGAAAAACAGG - Intronic
1106619883 13:31362899-31362921 AGATTGTGTTGCTGAACACCAGG - Intergenic
1109930541 13:69211079-69211101 GCATGGTGCTGATGTAAAACAGG - Intergenic
1112552497 13:100434689-100434711 GGATTGTGCAGGAGAAAAGCAGG - Intronic
1113297332 13:108973527-108973549 TGAATGTGCTGATGAAAATCTGG - Intronic
1115058827 14:29166502-29166524 GTATTTTGCTACTGAAAAAAAGG - Intergenic
1116387837 14:44354232-44354254 GGATTGTGCTGCTGAAGGTTGGG + Intergenic
1117291740 14:54341170-54341192 AGATGGTGTTTCTGAAAAACAGG - Intergenic
1118388594 14:65277743-65277765 GGAGTGTGTTGCTGATAAAAAGG + Intergenic
1119141624 14:72272560-72272582 GGATTTTGATGCTGAAATAATGG - Intronic
1119340315 14:73871553-73871575 GGTCTGTGCTTCTGACAAACTGG - Intronic
1119419948 14:74502631-74502653 GGTCTGTGTTGCTGCAAAACTGG - Exonic
1119672960 14:76533588-76533610 GGTTTGGGTTGCAGAAAAACAGG + Intergenic
1119879121 14:78086277-78086299 GGGTTGTGCAGATGAAAAGCTGG + Intergenic
1124643710 15:31419213-31419235 GATTTGTGCTTTTGAAAAACAGG - Intronic
1128651518 15:69418258-69418280 GGAGAGTGCTGCTGACAAACAGG - Intronic
1133530389 16:6649952-6649974 GAATTGTGCTGCTATAAAAGTGG + Intronic
1135288486 16:21214300-21214322 GGATTCTGCTCCGGAAAAGCAGG + Exonic
1137349249 16:47696750-47696772 TGATTGTGTGGCTGAAAAGCAGG - Intronic
1137440034 16:48490499-48490521 TTATTGTGCTGCTGAAAAAGTGG - Intergenic
1138766962 16:59616759-59616781 GCCCTGTGCTCCTGAAAAACAGG + Intergenic
1142580081 17:936539-936561 GGATTCTGCTGCGGAAAAACTGG + Intronic
1144067841 17:11640389-11640411 GTATTGTGTTCCTGAAAGACAGG + Intronic
1144323771 17:14157158-14157180 GGCTTGTGCGCCTTAAAAACAGG + Intronic
1145102538 17:20088869-20088891 GGATTGTGCTTGTGCAAAACAGG + Intronic
1149156731 17:53639806-53639828 GGATTATCAAGCTGAAAAACAGG + Intergenic
1151691796 17:75691087-75691109 GGATTCTGCTGCTGGGAAGCTGG + Intronic
1154070965 18:11150523-11150545 GCAGTGAGCTGATGAAAAACAGG + Intergenic
1155151145 18:23124056-23124078 GGATTGTAGTGATGAATAACAGG - Intergenic
1155921659 18:31609692-31609714 GGCTGGTGATGATGAAAAACAGG + Intergenic
1157309069 18:46538404-46538426 TGGTTGTGCTGGTGAAGAACTGG - Intronic
1158811747 18:61046257-61046279 GAATTGTGCTGCTGTAAACATGG - Intergenic
1164298743 19:23939407-23939429 GAATTGTGCTGCTGGAAATATGG + Intronic
925631462 2:5898266-5898288 GGATTGTGCTACTTAAATAATGG + Intergenic
926821929 2:16861328-16861350 GGATTTTGCTACCAAAAAACAGG + Intergenic
927448921 2:23189581-23189603 GGATTGATCTGCTGAAAGAGAGG - Intergenic
929842936 2:45489592-45489614 TGATGGTGATGATGAAAAACAGG - Intronic
929956144 2:46460188-46460210 GGTTTCTGCTTCTGTAAAACGGG - Intronic
932633409 2:73366804-73366826 GGATTTTGCTGCTGAAAGATTGG - Intergenic
933649893 2:84842122-84842144 GGATAGTGCTACTTAAAAAAGGG + Intronic
934882256 2:97994749-97994771 GTATTGTACTGCTGCAAAACGGG - Intronic
937674673 2:124577167-124577189 TGATAGTGCTGCGGAAAAAATGG - Intronic
938867320 2:135436330-135436352 GCATGGTGCTGCTACAAAACAGG - Intronic
940293666 2:152100635-152100657 TTCTTGTGCTTCTGAAAAACTGG + Intergenic
942542273 2:177026774-177026796 GGATTCTACTGCTAAAAAGCAGG - Intergenic
943163595 2:184286703-184286725 GGATTGTGTAGCTGAGAAACTGG + Intergenic
944276377 2:197843170-197843192 GGATTCTGATGCTCAAAACCAGG + Intronic
945680872 2:212912661-212912683 AGTTTCTGCAGCTGAAAAACAGG + Intergenic
1169367820 20:5005139-5005161 AGATTTTACTGCTGACAAACTGG + Intronic
1170030685 20:11940758-11940780 GGATTGTTCTGCAGAAACACAGG + Intergenic
1177191019 21:17851130-17851152 GGATTGTCCTCCTGGAAGACTGG + Intergenic
1177651191 21:23964063-23964085 GGAAGGTGGTGCTGCAAAACTGG - Intergenic
1178756423 21:35354420-35354442 GGATAATGCTGCTGTAACACAGG + Intronic
1179441266 21:41395970-41395992 TGATGGTGCTGATTAAAAACTGG + Intronic
1181383040 22:22522121-22522143 GGATTCTGCTTCTGGAAAAGAGG - Intergenic
1183668473 22:39258221-39258243 GGTTTCTGCTTCTGAACAACGGG + Intergenic
955003592 3:54949339-54949361 GGTCTCTGCTGCTGAAAAAAGGG + Intronic
955025274 3:55161473-55161495 TGTTTCTGCTGCTGAATAACTGG + Intergenic
956639552 3:71402737-71402759 GGAATGTGCTGCTGAGAAGTGGG + Intronic
958270114 3:91489197-91489219 GGATTATGCTTCTAAAAAAATGG - Intergenic
960005855 3:112780626-112780648 GGACTGAGCAGCTGAGAAACGGG - Intronic
960390744 3:117075004-117075026 GGACTGTGCTGCTGACTAATTGG - Intronic
961181926 3:124884583-124884605 TGATTGTCCTGCTGAGTAACTGG - Intronic
961636082 3:128333975-128333997 ATATTGTGCTACTCAAAAACAGG + Intronic
961664318 3:128486679-128486701 GAATCGAGCTGCTGAAAAATTGG - Intronic
962222885 3:133578758-133578780 GGATTGAGCTGCTGGAATACCGG - Intronic
962630137 3:137267339-137267361 TGATTGTGAAGCTGAAAAACAGG + Intergenic
962644152 3:137419667-137419689 GAATTATGCTGCCAAAAAACAGG - Intergenic
974112256 4:57538784-57538806 GTTGTGTGGTGCTGAAAAACAGG + Intergenic
977879480 4:102187611-102187633 GGAGTGTGATCCTGAAAAATGGG - Intergenic
979247442 4:118525049-118525071 GCATAGTGCTACTGACAAACTGG - Intergenic
979767137 4:124475522-124475544 GGTTTCTGCTGCTGAAAAACAGG - Intergenic
979830040 4:125288118-125288140 GAAATTTGGTGCTGAAAAACTGG + Intergenic
980484330 4:133435476-133435498 GCATAATGCTGCTGAAAATCAGG + Intergenic
980820107 4:138004121-138004143 GCATTGTGCTTTGGAAAAACAGG + Intergenic
986938211 5:12917825-12917847 GGTCTCTGCTGCTGACAAACTGG + Intergenic
987057517 5:14208939-14208961 GGATTGTGATGTTGTAAAACTGG + Intronic
987757705 5:22118241-22118263 AGATTGTGCAGCTAATAAACTGG - Intronic
991449117 5:66732984-66733006 GGATTATGATGCTGAGAAAAAGG - Intronic
993607158 5:90005835-90005857 GAATTGTGCTGCTGTAAACATGG - Intergenic
993791908 5:92219834-92219856 GGTTTCTGCTGCTGACAAATTGG - Intergenic
993968209 5:94384367-94384389 TCAGTGTGCTGCTCAAAAACAGG - Intronic
994515285 5:100764120-100764142 AGATGGTGAAGCTGAAAAACAGG - Intergenic
1000671663 5:164070873-164070895 GGATTTTGCTGTAGTAAAACTGG + Intergenic
1003186058 6:3831610-3831632 GGAGTGTGCTGCCCAAAAAGTGG + Intergenic
1006462022 6:34165293-34165315 GAATAGTGCTGCAGAAAAATGGG + Intergenic
1007949847 6:45861488-45861510 GGTTTCTGCAGCTGTAAAACAGG - Intergenic
1008985045 6:57532144-57532166 GGATTATGCTTCTAAAAAAATGG + Intronic
1009173081 6:60425100-60425122 GGATTATGCTTCTAAAAAAATGG + Intergenic
1009888069 6:69648720-69648742 TGATTGTGGTGTTGAAAAATAGG - Intergenic
1010678514 6:78771836-78771858 AGATTGTGCTGATAAAAAGCAGG + Intergenic
1010971498 6:82267619-82267641 TGTTAGTGCTGCTGACAAACTGG - Intergenic
1011795894 6:90950924-90950946 GAATTTTGCTGCTGAAAGTCAGG + Intergenic
1013458810 6:110356926-110356948 GGGTTGTGGTGCTGAAAAGTAGG + Intronic
1013924248 6:115449608-115449630 GGAGAGTGATGCTGAAAAATGGG + Intergenic
1015064497 6:129007312-129007334 GGAGTGAGCTCCTGGAAAACAGG + Intronic
1015475882 6:133658409-133658431 GGTTTCTGCTGCTGGCAAACTGG - Intergenic
1017583261 6:155890686-155890708 AGTTTGTGGTGCAGAAAAACTGG + Intergenic
1018511531 6:164529279-164529301 GGATCTTGCTGCTGAACTACAGG - Intergenic
1021011424 7:15472932-15472954 TCACTGTGCTGCTGAAAAAGAGG - Intronic
1024666377 7:51551072-51551094 GGATTGTGTTGCTTACACACTGG - Intergenic
1028923407 7:96331177-96331199 GGATTGGCCTGCTGAGGAACTGG - Intergenic
1031010446 7:116521106-116521128 GGGTGGTGATGCTGATAAACAGG + Intergenic
1032125587 7:129190093-129190115 AGTTTGTGCATCTGAAAAACCGG + Intronic
1033439617 7:141367044-141367066 GGATTGTGCTGCTGCCATTCAGG + Intronic
1034055427 7:148029906-148029928 GGATTGTGGTGGAGAAGAACAGG + Intronic
1035930987 8:3779578-3779600 CAATTATGCTGCTGAATAACCGG + Intronic
1036082511 8:5573003-5573025 AGACTGTTCTGCTGAAAAGCAGG - Intergenic
1037011174 8:13844604-13844626 GAATTATGCTGCTGTAAAATTGG + Intergenic
1038715618 8:29988141-29988163 GGATTCTGCTGCTGGAAATGGGG - Intergenic
1039127781 8:34222872-34222894 AGCTTGTGCTGCTGAGAATCAGG - Intergenic
1044029728 8:87221354-87221376 GTACTGTGCTTCTGACAAACTGG + Intronic
1047341593 8:123985752-123985774 GGATGCTGCTGGTGAAACACGGG - Intronic
1048413994 8:134206009-134206031 GCATTGTGGTGGTGAAGAACTGG + Intergenic
1048820453 8:138375728-138375750 GGATAATGATGATGAAAAACTGG - Intronic
1050744614 9:8860527-8860549 GGGTGATGCTGCTGAAAAACGGG + Intronic
1052069428 9:24064095-24064117 TGATATTGCTGCAGAAAAACAGG + Intergenic
1055065661 9:72115827-72115849 AGGTTGAGCTGCTGAAAAAGGGG + Intronic
1059163993 9:112061418-112061440 GGAGTGTGGTGGTGAAAAAGAGG - Intronic
1061752872 9:132792855-132792877 AGATTGAGCTGCTGAAGAAGTGG + Intronic
1186886175 X:13916037-13916059 GGATAGAGCAGCTGAAAATCCGG - Intronic
1188179019 X:27030598-27030620 GGATTGTGTTCATGAAGAACAGG + Intergenic
1192577725 X:72256125-72256147 GTATTGTGTTGAGGAAAAACCGG + Intronic
1193203878 X:78725063-78725085 GTTTTGTGCTGGTGAAAAATGGG + Intergenic
1194174750 X:90631753-90631775 GGTGTCTGCTGCTGACAAACTGG - Intergenic
1194579430 X:95653623-95653645 GGCTTGTGCTGAGGAAAAAGAGG + Intergenic
1194584241 X:95713984-95714006 GGTCTCTGCTGCTGGAAAACTGG - Intergenic
1197644744 X:129005208-129005230 GGATTGTGCTACTGAACCAGTGG - Intergenic
1200357288 X:155565308-155565330 GGCTTGTGGTACTGAAAAGCAGG + Intronic
1200521396 Y:4212942-4212964 GGTGTCTGCTGCTGACAAACTGG - Intergenic
1200971471 Y:9157062-9157084 TGCTGCTGCTGCTGAAAAACAGG + Intergenic
1201534075 Y:15026068-15026090 GAATTGTGCTGCTTAAGAACAGG + Intergenic
1201942525 Y:19475236-19475258 GGATCATGCTGCTGAAAGAAAGG - Intergenic
1202139551 Y:21707232-21707254 TGCTGCTGCTGCTGAAAAACAGG - Intergenic