ID: 1072097885

View in Genome Browser
Species Human (GRCh38)
Location 10:92200252-92200274
Sequence TAGGGCATACAGGCCGGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072097877_1072097885 1 Left 1072097877 10:92200228-92200250 CCTCAAAATAGCCCAGTATAAGA No data
Right 1072097885 10:92200252-92200274 TAGGGCATACAGGCCGGGCACGG No data
1072097875_1072097885 24 Left 1072097875 10:92200205-92200227 CCATGCAATAAATTCTCAAGAAC 0: 1
1: 0
2: 0
3: 14
4: 224
Right 1072097885 10:92200252-92200274 TAGGGCATACAGGCCGGGCACGG No data
1072097880_1072097885 -10 Left 1072097880 10:92200239-92200261 CCCAGTATAAGATTAGGGCATAC 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1072097885 10:92200252-92200274 TAGGGCATACAGGCCGGGCACGG No data
1072097876_1072097885 2 Left 1072097876 10:92200227-92200249 CCCTCAAAATAGCCCAGTATAAG 0: 1
1: 0
2: 0
3: 13
4: 197
Right 1072097885 10:92200252-92200274 TAGGGCATACAGGCCGGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072097885 Original CRISPR TAGGGCATACAGGCCGGGCA CGG Intronic
No off target data available for this crispr