ID: 1072100534

View in Genome Browser
Species Human (GRCh38)
Location 10:92225267-92225289
Sequence CAGAAAATGGGGTAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 622
Summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 567}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072100534 Original CRISPR CAGAAAATGGGGTAGGAGGC TGG (reversed) Intronic
900285799 1:1899764-1899786 CAGGAAATGGGGCTGGGGGCTGG - Intergenic
900542797 1:3212502-3212524 CAGAACATGGGGACGGAGGCAGG - Intronic
900706932 1:4086832-4086854 GGGAAAATGTGGGAGGAGGCGGG + Intergenic
900780084 1:4612270-4612292 CAGAAAAGGGGAGAGGAGGCGGG - Intergenic
900797632 1:4718775-4718797 CAGAAAGTGCCTTAGGAGGCCGG - Intronic
901032959 1:6319026-6319048 CAGTGAATGGGGTTGGGGGCTGG - Intronic
901091927 1:6647521-6647543 AAGAAACTGGGCTAGTAGGCCGG + Intronic
901236445 1:7669961-7669983 CAGAAAGTGGAGGAGGAGGGTGG - Intronic
901842669 1:11963923-11963945 CAGAACCTGGGGTATCAGGCTGG - Intronic
902330430 1:15728600-15728622 AAGAAAATGGGGCAGGGGGAGGG + Intronic
902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG + Intergenic
902733789 1:18386769-18386791 CAGACAATGGGGCTGGAGGAAGG + Intergenic
903164430 1:21510315-21510337 CACATAATGGGGTCGAAGGCGGG + Intronic
903811792 1:26038782-26038804 CTGAGAATGGGGCATGAGGCAGG + Exonic
904002908 1:27348970-27348992 CTGAAACTGGGGTAGCTGGCTGG + Intronic
904086849 1:27915383-27915405 CAGCAAATGGGGTCTGAGGCAGG + Intergenic
904371494 1:30050296-30050318 GAGAAAGAGGGGTAGGAGGAAGG + Intergenic
904910723 1:33932250-33932272 CAGAGAATGGGGTTGGAGGTGGG + Intronic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905337279 1:37253743-37253765 CAGAAACTGAGGGAGTAGGCTGG - Intergenic
905706502 1:40063806-40063828 CAACAAATGCTGTAGGAGGCTGG + Intronic
905950914 1:41949828-41949850 CAGAGCATGGGCTAGCAGGCTGG - Intronic
906040508 1:42785013-42785035 CAGGAAACGGGGCAGGAGGGCGG + Intronic
906196945 1:43935530-43935552 GAGAAACTGGGGTGGCAGGCCGG + Intronic
906217252 1:44050263-44050285 CTGCCAATGAGGTAGGAGGCAGG + Intergenic
907137950 1:52157126-52157148 TATAAAGTGGGGAAGGAGGCCGG - Intronic
907337025 1:53706515-53706537 CAGAAAATGCTGAAGGCGGCAGG - Intronic
907351608 1:53836764-53836786 TAGAATGTGGGATAGGAGGCTGG - Intronic
907391861 1:54163393-54163415 CAGCAAAGGGGGTAGGAAGAGGG - Intronic
907555055 1:55336159-55336181 CAGAAGAAGGGGCAGGAGGGAGG + Intergenic
907619403 1:55961186-55961208 CAGAATATGAGGTGGGAGGATGG - Intergenic
908169966 1:61494446-61494468 CCTAAAGTGGGGCAGGAGGCAGG + Intergenic
908903573 1:68983174-68983196 GAGAAAAGGGGGCAGGAGACAGG + Intergenic
909008841 1:70309367-70309389 CTGAAAATTGGGGAGTAGGCTGG - Intronic
909805238 1:79866768-79866790 AAGAAAATGGGTTTGGAGACAGG + Intergenic
910396479 1:86799214-86799236 CAGAAAATGGTGTGGGAGCCAGG - Intergenic
910847532 1:91617739-91617761 CAGAAAATCTGCTTGGAGGCTGG - Intergenic
911153464 1:94617586-94617608 CACAGAATGGGATAGGAGGTCGG + Intergenic
912210896 1:107555839-107555861 CAGCAAATGGGCAAGGAGACAGG + Intergenic
912255881 1:108057761-108057783 CAGGAAATGGGGTTGGGGGTGGG - Intergenic
912474643 1:109927860-109927882 TAGAAGATGGGGCAGCAGGCTGG + Intronic
912807887 1:112772592-112772614 TAGAAAATAGGGCGGGAGGCTGG - Intergenic
912859399 1:113199531-113199553 GAAAAAATGGGGTGGGAGGATGG + Intergenic
912865217 1:113250408-113250430 CAGAAAAGGGGAGTGGAGGCTGG + Intergenic
913203507 1:116515332-116515354 CAGACCACGGGGGAGGAGGCCGG - Intronic
914736911 1:150426699-150426721 CAGGGACTGGGGTAGGGGGCAGG + Intronic
914742322 1:150475241-150475263 GAGAAAATGGGGTGGGAGGTGGG + Intronic
914829859 1:151163158-151163180 CAGAGAATGGGATAGTAGGGGGG - Intronic
914982328 1:152425702-152425724 GAGATAATGAGGTAAGAGGCAGG + Intergenic
915138050 1:153747741-153747763 CAGATAATGGGGGTGGAGCCAGG - Intronic
916294070 1:163197413-163197435 CAGAAGTTGGGGTGGTAGGCGGG - Intronic
917762794 1:178182099-178182121 AAATAAATGGGGTAGGAGGGTGG - Intronic
918047846 1:180952172-180952194 CACAGAATGGGGTAGGGGGGTGG + Intergenic
919790720 1:201289093-201289115 CAGCAGAGGGGGCAGGAGGCTGG + Intronic
919884181 1:201920730-201920752 TAGAATAGGGGGTGGGAGGCTGG + Intronic
920041878 1:203103354-203103376 GGGAAGATGGGGAAGGAGGCAGG - Intronic
920144284 1:203844827-203844849 CAGAAAAAGGGGAGGGAGGAGGG - Intronic
920312415 1:205056472-205056494 CTCAGAATGAGGTAGGAGGCAGG - Intronic
920446649 1:206023145-206023167 GAGAAGATGGGGTGGGAGGGGGG + Intronic
920506705 1:206520308-206520330 AAGAAAATGGGTTTGGTGGCCGG + Intronic
922039151 1:221879072-221879094 CAGATAATAGGGTAGGGGGATGG + Intergenic
923537931 1:234867340-234867362 CATCAGATGGGGTTGGAGGCTGG + Intergenic
923795342 1:237148928-237148950 CAAAATTTGGGGTAGGGGGCTGG - Intronic
923956952 1:239032941-239032963 CTGAAAATGGGGTGGGTGGAAGG + Intergenic
924370143 1:243338986-243339008 CAGAAAGTGGGGTGGGCGGCAGG + Intronic
924370156 1:243339040-243339062 CAGAAAGTGGGGTGGGCGGCAGG + Intronic
924370169 1:243339094-243339116 CAGAAAGTGGGGTGGGCGGCAGG + Intronic
924596956 1:245454756-245454778 AAAAAAATGGGGTAGGAGAGAGG - Intronic
924615089 1:245605971-245605993 CATAAAGTGGGATGGGAGGCAGG - Intronic
924651630 1:245933941-245933963 CAGTAATTGGGGGAGGGGGCTGG - Intronic
1063112936 10:3052653-3052675 CCTAATATGGGGGAGGAGGCGGG + Intergenic
1063655430 10:7983315-7983337 CAGAATAAGGGGCAAGAGGCAGG + Intronic
1063668558 10:8081325-8081347 GAGAAAATGGGCTGGGAGGCTGG + Intergenic
1063887597 10:10595436-10595458 CTGAAAGTGAGGTGGGAGGCAGG + Intergenic
1064043590 10:11990431-11990453 CTTAAAAAGGGTTAGGAGGCCGG + Intronic
1064188572 10:13185469-13185491 GACAAAATGAGTTAGGAGGCTGG - Intronic
1064673869 10:17742204-17742226 CAGAAAGAGGGATAGGAAGCTGG + Intergenic
1064922572 10:20534154-20534176 CAGAAAATGGGTCAGGAGCTGGG - Intergenic
1065029854 10:21574917-21574939 CACAGAATGAGATAGGAGGCTGG - Intronic
1065066390 10:21969831-21969853 CAGAAGATGGGGTTGGGGGTGGG - Intronic
1066238370 10:33508978-33509000 CAGAAACTGGGGTGGGGGTCGGG + Intergenic
1066441282 10:35441468-35441490 TGGAAAAAGCGGTAGGAGGCTGG + Intronic
1066497394 10:35955400-35955422 CAGAACATGGGGTGGGGAGCAGG + Intergenic
1067460298 10:46453235-46453257 AAGAATATGGGGAAGGAGACAGG - Intergenic
1067626892 10:47931368-47931390 AAGAATATGGGGAAGGAGACAGG + Intergenic
1069227919 10:65967659-65967681 GATAAAATGATGTAGGAGGCTGG - Intronic
1069881931 10:71598566-71598588 CAGCTGATGGGGAAGGAGGCAGG + Intronic
1070037182 10:72737814-72737836 CAGAAAAAGGGGAAATAGGCTGG - Intronic
1070764960 10:79051048-79051070 CAGGAAATGGGATGGGAGGAGGG + Intergenic
1071074334 10:81732883-81732905 CAGCAGATGGGGTAGGAGAAGGG - Intergenic
1071102650 10:82057305-82057327 CAGAAATTGGAGTAGGAGTTAGG - Intronic
1071386119 10:85123075-85123097 CAGAGAAGGGGTGAGGAGGCAGG + Intergenic
1071420314 10:85489906-85489928 CAGAAAAAGAGGTTGGAGGAAGG + Intergenic
1071574750 10:86716855-86716877 GAGAGATGGGGGTAGGAGGCAGG + Intronic
1071979456 10:90988754-90988776 AAGAATGGGGGGTAGGAGGCTGG - Intergenic
1072100534 10:92225267-92225289 CAGAAAATGGGGTAGGAGGCTGG - Intronic
1072471466 10:95717832-95717854 CAGAGCATGGGCTAGCAGGCCGG + Intronic
1073057428 10:100711353-100711375 CAAGAAATGGAGTAGGAGGCTGG - Intergenic
1074501241 10:114026834-114026856 CATAAAATAAGGTAAGAGGCAGG + Intergenic
1074829697 10:117240351-117240373 CAGAGAAAGGGCTAGGGGGCGGG - Intergenic
1075442709 10:122492706-122492728 CAGAAAAGGGGGTAGGTGAGTGG - Intronic
1078608192 11:12796079-12796101 CAGAAACTGGGCCAGGAGGGGGG + Intronic
1078723658 11:13907828-13907850 CAGAAAATGTGGTTGGAGAAGGG - Intergenic
1078879496 11:15434072-15434094 CACAAAATGGGGTAGTAGCTGGG - Intergenic
1079051279 11:17162460-17162482 CTTAAAATGTGTTAGGAGGCAGG - Intronic
1079933346 11:26591352-26591374 CAGAGCATGGGCTAGCAGGCTGG + Intronic
1079935399 11:26609605-26609627 AAGAAAATGTGGTGGGGGGCGGG - Intronic
1080261050 11:30350103-30350125 CAGGAGCTGTGGTAGGAGGCAGG - Intergenic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083083530 11:60118511-60118533 CAGTAGATGGGGTAAGAGCCTGG + Intergenic
1083121164 11:60513064-60513086 AAGAAAAGTGGGTAGGAGGATGG + Intergenic
1083310325 11:61780560-61780582 TGGAACATGGGGTAGGAGGAAGG + Intronic
1083451782 11:62751102-62751124 CAAAGAAAAGGGTAGGAGGCTGG + Exonic
1083739192 11:64699049-64699071 CACCAAATGGGGTTGGAGGTAGG - Intronic
1083817840 11:65147049-65147071 CCCAAAGTGAGGTAGGAGGCAGG - Intergenic
1083914313 11:65730162-65730184 GGGAGAATGAGGTAGGAGGCAGG + Intergenic
1083940306 11:65891874-65891896 AAGACAATGGGGCAGGAAGCAGG + Intergenic
1084454606 11:69261219-69261241 CAGGAGATGGGGCAGGAGACTGG - Intergenic
1085512446 11:77095277-77095299 CAGAGAAGGGGGTGGGAGCCTGG - Intronic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1085841083 11:80012597-80012619 GAGAAGGTGGGGTGGGAGGCAGG + Intergenic
1085932753 11:81104803-81104825 TAGAAAATGGGGGAGGGGGGAGG - Intergenic
1086325691 11:85696525-85696547 CAGACAGTGGGGTAGGGGGTAGG + Intronic
1086607436 11:88712668-88712690 CAGAAAATAGACTAGGAGTCAGG + Intronic
1087875228 11:103347863-103347885 CAGAAACTGGGGTTGGTGCCTGG - Intronic
1088086259 11:105984267-105984289 GAGAAAATGGACAAGGAGGCAGG - Intergenic
1089072405 11:115710742-115710764 GAGAAGATGGGGTCGGAGGGGGG + Intergenic
1089763529 11:120746484-120746506 CAGAAAAGGGGGCTGGAGGAAGG - Intronic
1090853752 11:130593756-130593778 GAGAAAATGAGGAAGGAGGTAGG + Intergenic
1091145424 11:133275110-133275132 CAGCAAAGGGGGTGGGAGGCTGG + Intronic
1091201041 11:133781548-133781570 CTGAGAATTGGGTAGGAGTCTGG - Intergenic
1091467051 12:694002-694024 CAGAAACTGAGGTAGGAGGCAGG + Intergenic
1093627857 12:21371324-21371346 GTGAATATGAGGTAGGAGGCAGG - Intronic
1093685665 12:22050958-22050980 CAAAAGAGAGGGTAGGAGGCAGG - Intronic
1094470232 12:30796064-30796086 GAGAAAAGGGGGTTGGAGGTGGG - Intergenic
1094698099 12:32841657-32841679 CAGTTAGTGGGGAAGGAGGCAGG - Intronic
1095125731 12:38473932-38473954 CAGAGCATGGGCTAGCAGGCCGG - Intergenic
1095759838 12:45818560-45818582 CAAAAAATGGGGTTGGAGTTGGG - Intronic
1096072308 12:48782239-48782261 CAGAATGTGGGGCTGGAGGCAGG - Intronic
1097865569 12:64556820-64556842 AAAAAAAAGGGGTAGGGGGCAGG - Intergenic
1098513827 12:71350725-71350747 TAGAAAATGGGGTGGAAGTCAGG - Intronic
1098953763 12:76667954-76667976 CAGAAAGTGAAGTAGCAGGCTGG - Intergenic
1099624571 12:85053580-85053602 CAGAAAATGGAGGAAGAGTCAGG - Intronic
1100197221 12:92260539-92260561 GAGAAAATGGGAGAGGAAGCTGG - Intergenic
1100361909 12:93886938-93886960 CAGAGAGTGAGGTGGGAGGCTGG + Intronic
1100608234 12:96169467-96169489 AAGAAAAAGTGGTAGGTGGCAGG + Intergenic
1100616072 12:96232615-96232637 CAGGAGATGGGGGAGGGGGCGGG + Intronic
1101606635 12:106251801-106251823 CAGAAACTGGGGTAGGAGAATGG - Intronic
1102036081 12:109771279-109771301 CTGATATTGGGCTAGGAGGCTGG - Intergenic
1102159575 12:110757571-110757593 CAGAAAAATGGGAAGGGGGCTGG - Intergenic
1103021738 12:117539895-117539917 GAGAAAACAGGGTAGGAGTCAGG + Intronic
1103032945 12:117632520-117632542 TAGAAAAAGGAGTAGGTGGCAGG - Intronic
1103659980 12:122506447-122506469 TAGAAAATGGGGATGGAGGCTGG + Intronic
1103803840 12:123557242-123557264 CAGAGCATAGGCTAGGAGGCCGG - Intergenic
1105956519 13:25287927-25287949 ATGAAATTGAGGTAGGAGGCGGG - Exonic
1106822615 13:33482928-33482950 CAGAAAATCAGGTAGGAGGGAGG + Intergenic
1107557309 13:41528157-41528179 CTGAAACTGAGGTAGGAGGGAGG + Intergenic
1107602200 13:42024963-42024985 CTGATGATGAGGTAGGAGGCAGG - Intergenic
1108787126 13:53918203-53918225 TGGAAGATGGGGTAGGAAGCAGG + Intergenic
1109335884 13:60993030-60993052 CAAAGAATGGGGTAGGACCCAGG - Intergenic
1109379532 13:61541635-61541657 CAGAAAATGGGGTTGAAGAAGGG - Intergenic
1110323001 13:74181384-74181406 CAGAAAATTGAGAATGAGGCTGG + Intergenic
1111612690 13:90623953-90623975 CAGAAAATAAGGTGGGAGGGAGG + Intergenic
1113417108 13:110137003-110137025 GAGAGAGTGGGGGAGGAGGCAGG - Intergenic
1114590450 14:23859995-23860017 CAGAAAATGGAGGGGGAGCCTGG - Intergenic
1114690735 14:24577604-24577626 CAGACAGTGGGGTAAGAGGAGGG - Intergenic
1115358223 14:32472382-32472404 CATAAGGTGGGGTAGGAGGAGGG + Intronic
1115373970 14:32652418-32652440 AGGAAAATTGGGTAAGAGGCAGG - Intronic
1116446691 14:45019956-45019978 CAGAGCATGGGCTAGCAGGCTGG + Intronic
1117748248 14:58893204-58893226 CAGAAAAAGGGGCAGGAGACAGG + Intergenic
1118249661 14:64147295-64147317 AAGGAAATGAGGGAGGAGGCTGG - Intronic
1118306029 14:64656300-64656322 CAGAAAATAAGATAGAAGGCCGG + Intergenic
1118716086 14:68561086-68561108 CAGAGGAAGGTGTAGGAGGCAGG - Intronic
1120347956 14:83314162-83314184 CAGAAAATGATGCAGAAGGCTGG - Intergenic
1120620361 14:86755759-86755781 CAGCATAAGGGGTAGAAGGCAGG + Intergenic
1120819355 14:88897718-88897740 CAGAAAATGGATTAGGTGGGGGG - Intergenic
1121510459 14:94509410-94509432 CCGAAAAAGGACTAGGAGGCTGG - Intronic
1122055868 14:99097979-99098001 CAGTGAATGGGGAAGAAGGCTGG - Intergenic
1122816742 14:104317694-104317716 CCGAAAATGGGGTTGTGGGCAGG + Intergenic
1122983420 14:105201665-105201687 CTGAGATTGGGATAGGAGGCCGG - Intergenic
1123159551 14:106264655-106264677 CAGAAAAGTGTGCAGGAGGCCGG - Intergenic
1123190591 14:106565637-106565659 CAGAAAAGCGCGCAGGAGGCCGG - Intergenic
1124112691 15:26806821-26806843 CAGAGCATGGGGCAGGAGGTGGG + Intronic
1125104793 15:35957865-35957887 CAGAAAAGGGGGTGGCAGGAAGG + Intergenic
1125549913 15:40537466-40537488 CAGAGCAAGGGGTAGGAGACAGG - Intronic
1126176805 15:45743399-45743421 CAGAAATTGGGAAAGGAGGCAGG - Intergenic
1126359951 15:47835866-47835888 AATAAAATGGGGTTGGAGGAGGG - Intergenic
1127264039 15:57346850-57346872 CAGAATCTGGGGTGGGGGGCAGG + Intergenic
1127675111 15:61230619-61230641 CAGAACGTGGGGTAGGCGGAGGG + Intergenic
1127890217 15:63243684-63243706 CAGAATTTGGGGAAGGGGGCAGG + Intronic
1129255065 15:74329796-74329818 TAGAAGATGGGGAAGGAGGAGGG + Intronic
1129326556 15:74802976-74802998 CACAGAATGGGGAATGAGGCTGG - Exonic
1129996800 15:80013787-80013809 TAAAAAATGGGGAAGCAGGCTGG - Intergenic
1131792069 15:95975800-95975822 CAGAAAAGAGGGAAGGAGGAAGG + Intergenic
1132050628 15:98605064-98605086 CTGAAAATGGGTTTTGAGGCCGG - Intergenic
1132052952 15:98625689-98625711 TATAAAATGGGGTAATAGGCTGG + Intergenic
1132149526 15:99449593-99449615 GGAAAAATGGGGTGGGAGGCAGG + Intergenic
1133224906 16:4336441-4336463 CAGAACATGGCCTTGGAGGCCGG - Intronic
1133458283 16:5962448-5962470 CACATAATGGGAAAGGAGGCAGG - Intergenic
1133969782 16:10559273-10559295 CAGATACTAGGGCAGGAGGCTGG - Intronic
1134244464 16:12529670-12529692 CAGCAAATGGGGGCGGCGGCGGG - Intronic
1134661354 16:15986876-15986898 TAGAGAATGTGGAAGGAGGCCGG + Intronic
1134849504 16:17469442-17469464 GAGCACATGGGGCAGGAGGCCGG - Intronic
1135542716 16:23344695-23344717 CAGAGAATGGAGTTGGAGGTGGG + Intronic
1135588391 16:23688682-23688704 CAGAAGATGGGGATGCAGGCAGG - Exonic
1135774912 16:25249120-25249142 CAGAAGCTGGGGGAGGAGGAGGG + Intronic
1135869744 16:26138340-26138362 CATAAAAGGAGGTAGGAGGGAGG - Intergenic
1137589023 16:49682208-49682230 GAGAAAAAGGGGCAGGAGGAAGG - Intronic
1137738567 16:50742543-50742565 CTGTAAATGGGGTGGGGGGCGGG - Intronic
1137928412 16:52563700-52563722 AAGAAAATGGTGGGGGAGGCTGG + Intergenic
1138247184 16:55476638-55476660 CACGAAATGAGATAGGAGGCTGG - Intronic
1139137636 16:64223993-64224015 TAGATAATGGGGTAGGGTGCTGG + Intergenic
1139374201 16:66486704-66486726 AAGAAAAGAGGGGAGGAGGCTGG + Intronic
1139788020 16:69409734-69409756 AAGAAAAGGTGGTAAGAGGCTGG + Intergenic
1139875194 16:70140521-70140543 TAGAAAATGGGGAAGGCGCCAGG + Intronic
1140237350 16:73171483-73171505 CAGAAAATGGCGGGGGGGGCGGG + Intergenic
1140360590 16:74340608-74340630 TAGAAAATGGGGAAGGCGCCAGG - Intergenic
1140530395 16:75660760-75660782 CAGAAGATGGGGGAGGATGAAGG + Intronic
1140536500 16:75714667-75714689 CAGAAGATGGGGGAGGATGAAGG + Intronic
1141028905 16:80571021-80571043 CCCAAAATGGGGAAGGAGGAAGG + Intergenic
1141453909 16:84125706-84125728 CAGAAAGTCGGGTAGGTGGGTGG - Intronic
1141636384 16:85316167-85316189 CTGAAAATGGAATAGGTGGCTGG - Intergenic
1141934430 16:87227843-87227865 CAGGAAATGGGGCCGAAGGCTGG + Intronic
1142140138 16:88469124-88469146 CAGACATGGGGGTGGGAGGCTGG - Intronic
1142273728 16:89104738-89104760 CGGAAAATAAGGTTGGAGGCCGG + Intronic
1142358890 16:89616977-89616999 CAGAGAATGGGGCGGGAGGCTGG + Intronic
1143812213 17:9481177-9481199 TAGAAATTGGCATAGGAGGCCGG - Intronic
1144249839 17:13404784-13404806 TAGAAAATGGGCTGGGAGGCAGG + Intergenic
1145823220 17:27856724-27856746 CAGAGAGTGGGGTAGGGGCCAGG - Intronic
1146168793 17:30616282-30616304 CAGAGAATGGGGTGGGTGGGTGG - Intergenic
1146170769 17:30631166-30631188 CAGAGAATGGGGTGGGTGGGTGG + Intergenic
1146306379 17:31732879-31732901 CAGCAGGTGGGGTAGGGGGCAGG - Intergenic
1146344216 17:32047185-32047207 CAGAGAATGGGGTGGGTGGGTGG + Intronic
1146876383 17:36415678-36415700 CACAGAATGAGATAGGAGGCTGG - Intronic
1146997830 17:37336189-37336211 CAGAGCATGGGCTAGCAGGCCGG - Intronic
1147063002 17:37897195-37897217 CACAGAATGAGGTAGGAGGCTGG + Intergenic
1147431684 17:40375264-40375286 CTGATAGTGAGGTAGGAGGCGGG - Intergenic
1148097824 17:45066006-45066028 GAAAAAAAGGGGCAGGAGGCTGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148698394 17:49574685-49574707 CAGATGGTGGGGGAGGAGGCTGG + Intergenic
1149273670 17:55011985-55012007 CAGAGCATGGGCTAGCAGGCCGG + Intronic
1149747834 17:59116496-59116518 CAGAAAAGGAGGTAGGAGAAAGG - Intronic
1149946074 17:60929129-60929151 TATAAAATGAGGTAGGAGCCGGG + Intronic
1149962773 17:61130495-61130517 CATAAACTGGGGGAGGTGGCAGG - Intronic
1150142534 17:62742434-62742456 CACAAAATGGAGTAGGAGCCAGG - Intronic
1150781745 17:68128822-68128844 CAGAGAATGGGGTGGGTGGGTGG - Intergenic
1151412437 17:73940175-73940197 CAGAGAAGGGGGAAGGAGGGAGG + Intergenic
1151947184 17:77326089-77326111 TGGAAGAAGGGGTAGGAGGCGGG - Intronic
1153178460 18:2405833-2405855 GAGGAAATGGGATAGGAGGGAGG + Intergenic
1154335520 18:13461908-13461930 CAGAAAAAGTGGGAGGGGGCAGG + Intronic
1155174768 18:23292417-23292439 CAGAACCTGAGGGAGGAGGCTGG + Intronic
1155743885 18:29325462-29325484 GAGAAAATGGGATGGCAGGCTGG + Intergenic
1156252651 18:35365796-35365818 AAAAATATAGGGTAGGAGGCAGG + Intergenic
1156873304 18:41974552-41974574 AAGAAAATGGGGCAGGGGGTGGG - Intronic
1157654189 18:49369263-49369285 CAGGCAATGGGGAAGGAGGGTGG - Intronic
1157726683 18:49969834-49969856 GAGAGAATGGGGTAGAAGGTGGG - Intronic
1158264665 18:55648974-55648996 CAGAAAGTGGGGGAGCAGGAGGG - Intronic
1158467807 18:57707008-57707030 AAGAAAATGAGGAAGCAGGCCGG + Intronic
1159414357 18:68124972-68124994 AAGGAAATGCGGTAGGAGGCAGG + Intergenic
1159653302 18:71003086-71003108 CTGAAACTGAGGTAGGAGGCAGG + Intergenic
1159973205 18:74678430-74678452 CAGAAAATGGGGTTGCAGGCAGG - Intronic
1160540583 18:79618006-79618028 TAGAAAACGAGGAAGGAGGCGGG + Intergenic
1161209946 19:3061351-3061373 CAGGAAGTGGGGCAGGAGGGGGG - Intronic
1161778814 19:6278495-6278517 CAGAAAATGAGGTGGAAGGAGGG + Intronic
1162090350 19:8275646-8275668 CATAAAATGGGTTAACAGGCAGG - Intronic
1162092583 19:8290479-8290501 CATAAAATGGGTTAACAGGCAGG - Intronic
1162516155 19:11149081-11149103 CAGAAAAGGATATAGGAGGCTGG + Exonic
1162736790 19:12751556-12751578 CAGAGGTTGGGGGAGGAGGCAGG - Intergenic
1163561542 19:18022220-18022242 CAGAAAGTGGGGCAGGGAGCCGG - Intergenic
1164317842 19:24110023-24110045 CTGAAAATGAGTTAAGAGGCCGG - Intronic
1164730973 19:30504317-30504339 AGGAAAATAGGGAAGGAGGCTGG - Intronic
1164857364 19:31535556-31535578 CAGGTGATGGGGAAGGAGGCAGG - Intergenic
1164974075 19:32558676-32558698 AACAAAATGAGGTGGGAGGCAGG + Intergenic
1165742594 19:38212408-38212430 CAGAAACGGGGGTGGGGGGCTGG + Intronic
1165759452 19:38312125-38312147 CAAAAAACGTGGTAAGAGGCTGG + Intronic
1166079269 19:40433816-40433838 CAGAAAATGGAGACGGAGCCAGG + Intergenic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925828313 2:7872553-7872575 CAGGAAAAGGGGTAGAAGGGAGG - Intergenic
925886217 2:8395428-8395450 CAGAAATTGAGCTATGAGGCCGG + Intergenic
926076255 2:9945569-9945591 GAGAAACTGGTGTGGGAGGCAGG - Intergenic
926614988 2:14987964-14987986 CAGAAAATGGGAGAGAAAGCTGG - Intergenic
926825061 2:16898093-16898115 TAGAAAATGGGGAGGAAGGCTGG - Intergenic
926928106 2:18008772-18008794 GAGAAACTGGAGTAGGAGGGAGG - Intronic
926971889 2:18474783-18474805 CAGATAATAGGGTAGGAAGCAGG + Intergenic
927464112 2:23324253-23324275 CAACAAATGGGGTGGGAGACAGG + Intergenic
928087166 2:28353027-28353049 CAGAAAAAGGGGCTGGAGGGAGG + Intergenic
928093096 2:28388253-28388275 CAGAGAAGGAGGTAGGAGGTGGG + Intergenic
928348099 2:30519335-30519357 CAGAGCATGGGCTAGCAGGCCGG - Intronic
929093790 2:38245126-38245148 CTGGTAATGAGGTAGGAGGCAGG + Intergenic
929271866 2:39981471-39981493 GAGAAGAAGGGGTAGGAGGCTGG + Intergenic
929511688 2:42569397-42569419 CAGAAGACTGGGAAGGAGGCAGG - Intronic
930158400 2:48128497-48128519 GAGGAAATGGGGGAGGAGGAAGG + Intergenic
930235064 2:48880911-48880933 CATAAAAGGCGGGAGGAGGCAGG + Intergenic
930721397 2:54641673-54641695 CAGGGAATGGGGCAGGGGGCGGG - Intronic
931102421 2:59017387-59017409 CAGAAAAGGGGAAAGGAGGGAGG + Intergenic
931245989 2:60493410-60493432 CAGGGAATGGGGTGGGAGGGGGG - Intronic
931348840 2:61470847-61470869 AAGAGAATGGGGGAGGGGGCCGG + Intergenic
932233558 2:70102711-70102733 CAGCAGGTGGGGCAGGAGGCCGG - Intergenic
932266056 2:70367763-70367785 GCAAAAATGAGGTAGGAGGCAGG + Intergenic
932580971 2:72992543-72992565 CTGGAAATGGGCGAGGAGGCTGG - Intronic
933405533 2:81853302-81853324 AAGGAAATGGGGTAGAAGGAAGG - Intergenic
934046492 2:88176988-88177010 AAGACAAGGGAGTAGGAGGCAGG - Intronic
934744599 2:96750887-96750909 CAGAAAGAGGGGTTGGTGGCAGG + Intergenic
934919005 2:98326809-98326831 CAGAAAATGGGGGAGGAATAGGG + Intergenic
935749157 2:106215173-106215195 CAGAGCATGGGCTAGCAGGCAGG - Intergenic
935857691 2:107293063-107293085 CAGAGATTGTGGTAGGAGCCAGG - Intergenic
935976744 2:108585895-108585917 TAGAAAATGGTGTCTGAGGCCGG + Intronic
938408811 2:131047254-131047276 CAGAAAACGGGCTAGCAGCCAGG - Intronic
939028130 2:137038697-137038719 CAGAAAAGGGTCAAGGAGGCAGG + Intronic
939168655 2:138667655-138667677 CAGAATATGGGGTAGGAGATTGG + Intergenic
940788873 2:158011059-158011081 AAGATAATGAGGGAGGAGGCCGG - Intronic
941370523 2:164658391-164658413 CAGAGCATGGGCTAGCAGGCCGG + Intronic
941991348 2:171560505-171560527 CAGAGCATGGGCTAGCAGGCCGG + Intergenic
942286395 2:174421708-174421730 CAGAAAATGGGGAGGGAACCTGG - Intronic
942339373 2:174927079-174927101 CAGATATTGGGGAAGGAGGAAGG - Intronic
942342833 2:174967228-174967250 CAGCTACTGGGGTAGGAGGCAGG + Intronic
942419651 2:175794895-175794917 GAGAAAAAGGGGCAGGAGACAGG + Intergenic
942552805 2:177137362-177137384 CAGAAGATGGGGAAAGGGGCTGG - Intergenic
943464958 2:188217867-188217889 AAGAAAAGGGAGCAGGAGGCTGG - Intergenic
944014812 2:195022691-195022713 CAGAAAATGGGGTTGGATGGGGG + Intergenic
944932720 2:204536226-204536248 GAGAAAGAGGGGTAGGGGGCAGG + Intergenic
945973380 2:216252021-216252043 CAGAAATTGGTGTGTGAGGCCGG - Intergenic
946049750 2:216852621-216852643 CAGAAAATGGGGTACGAAGGAGG - Intergenic
946174956 2:217916907-217916929 CAGAGAATGGGCAGGGAGGCCGG + Intronic
946350158 2:219145635-219145657 TAGAAAATGGGGCAATAGGCCGG + Intronic
946795030 2:223341397-223341419 TATAAAATGGCATAGGAGGCTGG + Intergenic
947181810 2:227418000-227418022 CAGAGGAATGGGTAGGAGGCAGG - Intergenic
947758765 2:232588204-232588226 GAGAGCATGGGGTGGGAGGCTGG - Intergenic
947858686 2:233342861-233342883 CAGAAGCTGAGGTAGGAGGGTGG - Intronic
949072444 2:242033675-242033697 CAGAAAATGGGCTAGGAGGAGGG - Intergenic
1168838612 20:894461-894483 CAGAGCATGGGCTAGCAGGCTGG + Intronic
1169147411 20:3261931-3261953 CAGAAAATGTGGAAGGAGGGTGG + Intronic
1169211677 20:3769165-3769187 CAGAAAGAGGCGGAGGAGGCAGG - Intergenic
1170153511 20:13249332-13249354 CAGAACTAGGGGTGGGAGGCAGG - Intronic
1170577682 20:17676604-17676626 CATATATTGGGGTAGGATGCTGG + Intronic
1170699278 20:18688825-18688847 CAGAATATTGAGTAGGAAGCAGG + Intronic
1171015826 20:21540910-21540932 CAGGAAATGGAGGAGGAGGTGGG + Intergenic
1171282622 20:23913892-23913914 CAGGAATTGGTGTAGGGGGCGGG + Intergenic
1171444598 20:25194905-25194927 CAGAAAATGGGGTCAAGGGCCGG + Intergenic
1171997083 20:31739754-31739776 CAGAAACTGAGGAAGGAGGAAGG + Intronic
1172186448 20:33034065-33034087 CATGACATGGGATAGGAGGCCGG + Intronic
1172620616 20:36316177-36316199 CAGGAAATCAGGTAGGAGGCGGG - Intronic
1172937094 20:38628277-38628299 CTGATAATGAGGTAGGAGGTGGG - Intronic
1173267755 20:41501116-41501138 AAGGAAATGAGGTAGGAAGCTGG - Intronic
1173551931 20:43938468-43938490 CAGGACATGGGGCAGGAGCCAGG - Intronic
1173674035 20:44818317-44818339 CACAAAATGGAGGAAGAGGCAGG + Intergenic
1173712881 20:45175998-45176020 AAGATAATGGGGCAGGAGCCAGG - Exonic
1173998405 20:47357232-47357254 CAGAAAAAGGGGCTTGAGGCAGG + Intergenic
1174211100 20:48878632-48878654 CAGAAAAAGGGGAATGTGGCCGG - Intergenic
1174873824 20:54207437-54207459 CCAAAAACGGGGAAGGAGGCAGG + Intergenic
1174951336 20:55044575-55044597 CAGACAATCAGTTAGGAGGCAGG + Intergenic
1174977655 20:55352559-55352581 CAGAGCATGGGCTAGCAGGCTGG - Intergenic
1175748042 20:61475413-61475435 GAGAAAGTGGTGGAGGAGGCTGG - Intronic
1175862023 20:62155668-62155690 CAGGAGATGGGGTTGGAGGAGGG - Intronic
1176162500 20:63654879-63654901 AAGAGAATGGGCTTGGAGGCAGG + Intergenic
1178167463 21:29996263-29996285 GAGAAAATGTAGTAGGAGCCAGG - Intergenic
1178810031 21:35873065-35873087 TAGAAAATGAGCAAGGAGGCTGG + Intronic
1179073761 21:38098700-38098722 CAGGAAAGGGAGTAGGAGGCAGG - Intronic
1180798613 22:18620595-18620617 CAGAGAATGGAGTAGAAGGAAGG + Intergenic
1181017848 22:20081308-20081330 CAGCAAGTGGGCTAGGAGGAAGG + Intronic
1181223103 22:21374669-21374691 CAGAGAATGGAGTAGAAGGAAGG - Intergenic
1181255635 22:21560965-21560987 CAGAGAATGGAGTAGAAGGAAGG + Intronic
1181536525 22:23549133-23549155 CTGCACATGGGGTAGGGGGCAGG + Intergenic
1181675675 22:24450101-24450123 CAGGGAATGGGGTAAGAGGATGG - Intergenic
1182361947 22:29751859-29751881 CAGGAAGTGAGGCAGGAGGCTGG + Intronic
1183545763 22:38454285-38454307 CAGAAATGTGGGTAGGGGGCAGG + Intronic
1184329898 22:43820786-43820808 CTGGAAATGGGGCAGGAGTCAGG - Intergenic
1184621011 22:45676889-45676911 CAGCTACTGGGGAAGGAGGCAGG - Intronic
949546839 3:5080053-5080075 AACAAAATGGGGATGGAGGCTGG - Intergenic
950522914 3:13506987-13507009 AAGGACATGGGGTAGCAGGCAGG + Intergenic
950631066 3:14282271-14282293 CAGAAAAACAGGTAGGAGCCAGG - Intergenic
950641216 3:14349736-14349758 TAGGAATTGGGGTAGGGGGCGGG - Intergenic
951478737 3:23136364-23136386 CAGAAAATGGGGTATAACACAGG - Intergenic
952344164 3:32468545-32468567 CAAAAAATAGGGAAGGAGGGAGG - Intronic
953096425 3:39781154-39781176 CAGAAAACAGGTTAGTAGGCAGG - Intergenic
953178496 3:40574254-40574276 CAGAGAATGAGGGAGGAGGGAGG + Intronic
953552143 3:43911495-43911517 GAGAAAATGAGGTAGAAAGCAGG - Intergenic
953640410 3:44701741-44701763 AAGAAAATGGCTTTGGAGGCCGG - Intergenic
953958799 3:47251267-47251289 CAGAAGGTGATGTAGGAGGCTGG + Intronic
954115389 3:48464371-48464393 CAGAATAGGGGGCTGGAGGCAGG + Intronic
954580291 3:51699578-51699600 CAGAAGGTGGGGTATGAGGATGG + Intronic
955162246 3:56475444-56475466 CAGAAAATGGGATTGGGTGCTGG + Intergenic
955440892 3:58953988-58954010 GAGAAAATGGGGTAGTTGACGGG + Intronic
956453013 3:69392663-69392685 CACAGAATGGGGTAAGAGGTTGG + Intronic
956484874 3:69711499-69711521 CTGAAATTGAGGTAGGAGGTGGG + Intergenic
956999854 3:74873302-74873324 CAGAGCATGGGCTAGCAGGCTGG + Intergenic
957553000 3:81731113-81731135 CAGAAAATGGTATAGGATGTTGG - Intronic
958590298 3:96149600-96149622 CAGAAATGGTGTTAGGAGGCTGG - Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960255172 3:115504002-115504024 CAGAAAATGGGGGTGGTGGATGG - Intergenic
960991220 3:123312951-123312973 CTGAACATGGGGCAGGAGGGAGG + Intronic
961181785 3:124883575-124883597 CAGGAAATGTGGTAGGGGGTTGG + Intronic
962090889 3:132243003-132243025 CAGGATACGGGGTAGGAGGAGGG - Intronic
962281250 3:134053642-134053664 CAGAAGGTGGGGTAGGACTCGGG - Intergenic
962462590 3:135628371-135628393 CAGGAAGTGGGGAAGGAGGAAGG - Intergenic
962546720 3:136443921-136443943 CAGAAAATGGGGGTGGAGTAAGG - Intronic
963313438 3:143733348-143733370 AAGAAATGGGGGTAGGAGGAGGG + Intronic
964316361 3:155448732-155448754 TAGAAAAAGGGGTAGGAGAATGG - Intronic
965505374 3:169509504-169509526 GAGGAAATGGGGGAGGAGGCAGG - Intronic
966353998 3:179059662-179059684 CGGAGAATGGGCTAGCAGGCTGG - Intronic
967066351 3:185920440-185920462 CAAAAAATGAGGCAGGAAGCCGG - Intronic
967829805 3:193909297-193909319 CAGGAGCTGGGGCAGGAGGCAGG + Intergenic
967833676 3:193943253-193943275 CTGAAAACAGGGTAGGAGGAGGG - Intergenic
968441562 4:626969-626991 CAGAAAAGGGGAGAGGAAGCTGG - Intronic
968441702 4:627693-627715 CAGAAAAGGAGGGAGGAGGGTGG - Intronic
968520747 4:1033714-1033736 CAGACAATGAGGATGGAGGCTGG - Intergenic
968694666 4:2017764-2017786 GAGAAAATGAGGTGGAAGGCTGG + Intronic
968961173 4:3744453-3744475 CAGAACCTGGGGTAGGTAGCCGG + Intergenic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
969692809 4:8713829-8713851 CAGGGAATGGGGTAGGGGGAGGG + Intergenic
969692899 4:8715435-8715457 CAGAAAATAGAGGAGGAGGAAGG - Intergenic
970391555 4:15617243-15617265 AAGAAAATGTGGTACAAGGCCGG + Intronic
970652454 4:18193628-18193650 AAGAAACTGGGGGAGGGGGCGGG - Intergenic
970838005 4:20434189-20434211 ACGAAAATGGGGAAGGAGGCTGG + Intronic
973758898 4:54099916-54099938 GAGAAAGAGGGGGAGGAGGCCGG + Intronic
973774645 4:54232464-54232486 GAGAAACTGCAGTAGGAGGCAGG - Intronic
975370913 4:73586486-73586508 CAGAAAGGGGGGCAGAAGGCAGG - Intronic
975669471 4:76766427-76766449 CAGAGGATGAGGTGGGAGGCAGG + Intronic
976587114 4:86811353-86811375 CAGAGAATGGGATAGCATGCTGG + Intronic
977581369 4:98728713-98728735 CAGCAGATGGGGTGGGAGGAAGG + Intergenic
977978776 4:103297920-103297942 AAGAAAATGTGGTGCGAGGCTGG - Intergenic
978401223 4:108333180-108333202 AAGAAAGTGGGGAAGGAGGGAGG - Intergenic
979724346 4:123942550-123942572 CAGCAAATGGGGGTGGGGGCGGG - Intergenic
979833458 4:125330352-125330374 TAGAAATTGGTGAAGGAGGCTGG - Intronic
980125676 4:128771689-128771711 TAGAAATTGGAGTAGAAGGCCGG + Intergenic
980774108 4:137417013-137417035 CAAAAAAGTGCGTAGGAGGCTGG + Intergenic
981462328 4:145028042-145028064 GAGAAAATGGGGAGGGAGCCAGG + Intronic
981724712 4:147834855-147834877 GAGAAAATGGGGAGGGAGCCAGG - Intronic
982709353 4:158744605-158744627 GAGAAAATGGGGTGAGAGACAGG + Intergenic
984197507 4:176676730-176676752 CAGATACTGAGGTAGGAGGTGGG + Intergenic
984509359 4:180659845-180659867 AAGATAATCGGTTAGGAGGCTGG + Intergenic
984908016 4:184648464-184648486 CTGAGAATGGGGGAAGAGGCAGG + Exonic
985497467 5:217964-217986 CAGGGAATGGGGTCGGAGGGGGG - Intronic
985769231 5:1798753-1798775 CAGCAGATGGGGCAGGAGGCCGG + Exonic
986824070 5:11501711-11501733 CATAAGAAGGGGCAGGAGGCTGG + Intronic
987047919 5:14124828-14124850 AAAAAAATGGAGAAGGAGGCCGG + Intergenic
987557263 5:19469691-19469713 CAGAAATCTGGGTAGGAGGAGGG - Intergenic
987940126 5:24523077-24523099 CAGAAAACGGGGATGGGGGCAGG + Intronic
988956872 5:36329166-36329188 CAGAGCATGGGCTAGCAGGCCGG + Intergenic
990074080 5:51820960-51820982 CAGAAAGTGGGGAGGGATGCAGG - Intergenic
990088409 5:52008237-52008259 GAGAAAATGGGATAGGAGTAAGG + Intronic
990503119 5:56416747-56416769 CAGAAAAGGGAATAGGAAGCAGG + Intergenic
990617243 5:57520490-57520512 CAGAGCATGGGCTAGCAGGCCGG + Intergenic
990979847 5:61592722-61592744 AAGAAAATGGTGAAGGATGCTGG + Intergenic
991117808 5:62974332-62974354 CAGAAGATTGGGTGGGAGGGAGG - Intergenic
991152688 5:63389447-63389469 CAGAAATTGTGTTAGGAGGTGGG - Intergenic
992081895 5:73241372-73241394 CTGAAAAGGTGGTAGGAGGAAGG + Intergenic
993062155 5:83051270-83051292 CAGAAATTGGGCTAGAATGCAGG - Intergenic
993298450 5:86175261-86175283 TAGGAAGTGAGGTAGGAGGCAGG + Intergenic
993460672 5:88177230-88177252 CAGAGCATGGGCTAGCAGGCCGG + Intergenic
994006594 5:94844771-94844793 CAGAAATTGGTGTGGGAGGAAGG - Intronic
996015062 5:118524268-118524290 CAGACAATGGGGTGAGTGGCGGG + Intergenic
996266349 5:121545560-121545582 CAGAAGATGGGGCTGGAGGTGGG - Intergenic
996576612 5:124983079-124983101 CAGAAAAAGGCGTAACAGGCTGG - Intergenic
997223877 5:132194460-132194482 CAGAAGATGAGGCTGGAGGCTGG - Intronic
997434282 5:133863073-133863095 CAGAAATAGGGGAAGGTGGCAGG - Intergenic
997717174 5:136051016-136051038 CACAAAATGGGGAATGAGGGCGG + Intronic
998519670 5:142788347-142788369 AAAAAAATGGGGTGGGAGTCGGG - Intronic
998638799 5:143986464-143986486 GAGAAAATGGGGTTATAGGCTGG - Intergenic
998778386 5:145628966-145628988 CAGAAAATGGGCAAGGAAGGTGG + Intronic
998978958 5:147679275-147679297 TAGAAAATGTAGTTGGAGGCTGG - Intronic
999991915 5:157057821-157057843 CAGAGAATGGGGTAGGGGAAGGG - Intronic
1000012889 5:157249275-157249297 CAGAAAATCGAGAAGGAAGCTGG - Intronic
1000440437 5:161256845-161256867 CAGAAAAAGTGGGAGGTGGCTGG - Intergenic
1001220459 5:169895905-169895927 CAGAAAATAGGGAAGAAGGAAGG - Intronic
1001490154 5:172149354-172149376 GGGAAAGTGGGGGAGGAGGCTGG - Intronic
1001768408 5:174273338-174273360 CAGAGACTGGAGTTGGAGGCAGG - Intergenic
1001889430 5:175326874-175326896 CAGAGGATGGGGCTGGAGGCTGG - Intergenic
1002398443 5:178976210-178976232 CAGAGAATGGGGCAGCTGGCGGG - Intergenic
1002917888 6:1543605-1543627 GAGAAAAAGGGGTAGGAACCTGG - Intergenic
1003186616 6:3837578-3837600 CATAAAATGGGCTAAGATGCTGG - Intergenic
1003353267 6:5340849-5340871 CACAAAATGGATGAGGAGGCCGG + Intronic
1003550472 6:7098387-7098409 CTGAAGATGTGGAAGGAGGCAGG - Intergenic
1004186073 6:13422339-13422361 CAGAAAATGGCGTAGCTGGAGGG + Intronic
1004365793 6:15011423-15011445 CAGGAACTGGGGGAGGAGCCTGG + Intergenic
1005039531 6:21588499-21588521 CAGGGGATGGGGTAGGAGGACGG + Intergenic
1006097489 6:31665269-31665291 CAGAAAATGGGCTTGGAGCGGGG - Intronic
1006442358 6:34060438-34060460 CGGGAAGTGGGGTAGGAGGCGGG - Intronic
1006592145 6:35166187-35166209 CAGAGAATGGGGGAAGAGGGAGG + Intergenic
1006627552 6:35408108-35408130 CAGAAGACAGGGTAGGAGGGTGG - Intronic
1006798305 6:36744463-36744485 CAGAAAAGGGGGTAGGGAGAGGG + Intronic
1007543585 6:42672785-42672807 AAGAAAGTGGGGAAGGAGGCAGG - Intronic
1007599957 6:43075569-43075591 CAGCAAGGGGTGTAGGAGGCGGG - Intergenic
1007711729 6:43828352-43828374 CAGCCAATGGGGCAGGGGGCAGG + Intergenic
1007784598 6:44272399-44272421 CAGAACATGGGGAATGAGACTGG + Intronic
1009970241 6:70617561-70617583 GAGAATATGGGGTGGGAGGGGGG + Intergenic
1011125420 6:84002386-84002408 CAGCAAATGGGGAAGGAAGAGGG - Intergenic
1011509341 6:88082735-88082757 CAGAAAATTGAGTAAGAGGATGG + Intergenic
1012295080 6:97512367-97512389 GAGAAAATGGGGTAGGTGCCTGG + Intergenic
1012520170 6:100111800-100111822 CAGGATATGGGCCAGGAGGCTGG + Intergenic
1013207626 6:107958637-107958659 TAGAATAGGGGGTGGGAGGCCGG + Intergenic
1013363022 6:109411939-109411961 GGGAAAATGAGGTAGGAGGCAGG + Intronic
1013364305 6:109424206-109424228 CAGACAGTGGGGTTGGGGGCAGG + Intronic
1014592962 6:123295019-123295041 CAGGAAATGAGGAAGGAGGCAGG + Intronic
1015596942 6:134875020-134875042 CAGAAAAGGAGTTAGAAGGCCGG - Intergenic
1015979240 6:138822253-138822275 CATTACATGGGGAAGGAGGCCGG + Intronic
1016392325 6:143586885-143586907 AACATAATGAGGTAGGAGGCGGG - Intronic
1016594482 6:145784006-145784028 CAGGAAAAGGGTTAAGAGGCGGG - Intergenic
1017813315 6:157999669-157999691 CAGAAATTGGGGCAGGTGGTGGG + Intronic
1018761486 6:166897763-166897785 CAGAGCATGGGCTAGCAGGCCGG - Intronic
1019182424 6:170198971-170198993 CTGAGAATGGGGATGGAGGCAGG + Intergenic
1019562828 7:1666631-1666653 CAGAAAGAGGGGGAGGGGGCTGG + Intergenic
1021255518 7:18387555-18387577 TAGAAAATGAGGAAGGAGGTAGG + Intronic
1021436220 7:20619069-20619091 AAGAAAATGTGGTACGTGGCTGG - Intronic
1021593266 7:22288024-22288046 AAGAAAATGAGGTAAGATGCTGG - Intronic
1023050331 7:36245520-36245542 CAGTAGATTGGGTAGGAGGTGGG + Intronic
1023610825 7:41968564-41968586 AAGAAAATGTGGAAGGAGGGAGG - Intronic
1023721964 7:43105224-43105246 AAGAAAATGTGGTGGGAGGAGGG + Intergenic
1023907550 7:44533317-44533339 CAGAGAATGGGGTGGGGGACAGG - Intronic
1024139313 7:46445870-46445892 CAGTAAATTGGGGAGGAGACAGG - Intergenic
1024698641 7:51883403-51883425 CAGGAGCAGGGGTAGGAGGCAGG - Intergenic
1025012183 7:55406380-55406402 CAGAAGATGGGGGAGCAGTCAGG + Intronic
1025265722 7:57455246-57455268 CAGAAAATGGGGTTGTATGTTGG + Intronic
1025624265 7:63205456-63205478 CTGAACATGGGGTTGGAGCCTGG + Intergenic
1025719080 7:63992982-63993004 CAGAAAATGGGGTTGTATGTTGG + Intergenic
1025747227 7:64253824-64253846 CAGAAAATGGGGTTGTATGTTGG + Intronic
1025838667 7:65123019-65123041 GTGGAAATGGGGTAGAAGGCCGG - Intergenic
1025884405 7:65572963-65572985 GTGGAAATGGGGTAGAAGGCCGG + Intergenic
1027796121 7:82695859-82695881 CACAAGATGAGGTAGGAGGTGGG + Intergenic
1028379166 7:90178721-90178743 CAGAACAAGGGCTGGGAGGCAGG + Intronic
1029422082 7:100477099-100477121 CAGAAAATGAAGTAGGAGGAAGG + Intronic
1029746981 7:102521435-102521457 CAGAAAACTGGATAGGAGGCAGG + Intergenic
1029764934 7:102620524-102620546 CAGAAAACTGGATAGGAGGCAGG + Intronic
1029983444 7:104900462-104900484 CAGAAAATGGCCTAAGAGTCAGG - Intronic
1030214365 7:107028702-107028724 AAGAAAAGAGGGTAGGAGACAGG + Intergenic
1030230336 7:107201964-107201986 CAGAACATGGGGCAGGTGGCTGG + Exonic
1030542556 7:110850159-110850181 CAGCAATTAGGGTAGGAGACTGG + Intronic
1030952442 7:115808142-115808164 CAGAATATGGGATGGGAGCCAGG - Intergenic
1031216672 7:118901390-118901412 CAGAAAATGGGGAATGAAGGTGG - Intergenic
1032472870 7:132190919-132190941 CAGTAAATGGGGTGGGGTGCAGG + Intronic
1032676014 7:134130061-134130083 GACAAAATGGGGTATGAGGAAGG - Intronic
1032701528 7:134384052-134384074 CAGATAGTGGGGTGGGTGGCAGG - Intergenic
1032846276 7:135754456-135754478 CAGGAGATGGGGTAGGAGAGAGG + Intergenic
1033756389 7:144400831-144400853 CAGAAAATGAGGCTGGAGCCAGG - Intronic
1035031118 7:155861343-155861365 CACGAAATGGGGAGGGAGGCAGG + Intergenic
1035173513 7:157033929-157033951 CAGGACGTGGGGTGGGAGGCAGG + Intergenic
1035343339 7:158179670-158179692 GAGATAATGAGGTAGGAGGCAGG + Intronic
1036217347 8:6891726-6891748 CAGGAAGTGGGGTAGGACCCAGG + Intergenic
1036943531 8:13073211-13073233 CAGTAAATGGGCTAGAAGTCAGG - Intergenic
1037018073 8:13933194-13933216 CAGAAGATGTGGTGGGAGGAAGG - Intergenic
1037579055 8:20233936-20233958 CAGATAAAGGGGTTGGAGGGAGG + Intergenic
1037739855 8:21599812-21599834 CAGGAGAAGGGGTAGGAGGAAGG + Intergenic
1037999752 8:23381636-23381658 TAGAAAAAGGGGTATAAGGCAGG - Intronic
1038249565 8:25890485-25890507 CAGAACATGGGTTTGGAGTCAGG + Intronic
1038590445 8:28832529-28832551 CAGCAAATGGGTTAGGAGTATGG + Intronic
1039229970 8:35433952-35433974 CACAAAATAGAGTAGGAGTCAGG - Intronic
1039881946 8:41630598-41630620 CAGAATGTGGGGTGGGGGGCCGG - Intergenic
1040288045 8:46110396-46110418 GCGAAAATGGGGTAGCAGGGTGG - Intergenic
1040546442 8:48401626-48401648 CTGCAAAAGGGGTAGGAGGAAGG + Intergenic
1041333270 8:56751534-56751556 CAGAAAATGGGATGAGGGGCAGG + Intergenic
1041333835 8:56757671-56757693 CACAAAAAGGGGAAGGAGTCAGG + Intergenic
1042027845 8:64443106-64443128 CAGAATAAGGGGTGGGAGACAGG + Intergenic
1044501888 8:92967096-92967118 CAGAAAATGATTTAGGAGGACGG - Intronic
1044946701 8:97396294-97396316 CAGAAGATGGGGAGGGAAGCGGG - Intergenic
1045680427 8:104653747-104653769 GAGAAAACGGGGCAGGAGGTGGG + Intronic
1046077482 8:109330885-109330907 CAGAGAATGGGGTAGGGGGAGGG + Intronic
1046324311 8:112620725-112620747 CACAAGATGCAGTAGGAGGCGGG - Intronic
1046626802 8:116584087-116584109 CAGTAGGTGGGGTTGGAGGCAGG - Intergenic
1047830853 8:128628150-128628172 CAGAAAAGAGGGAAGGAGGATGG - Intergenic
1047835783 8:128689149-128689171 GAGGAAATGGAGTAGGAAGCTGG + Intergenic
1049010269 8:139882646-139882668 CAGCACAGGGGGTAGGAGGGTGG + Intronic
1049477973 8:142805702-142805724 CTGAAAAGGGGCCAGGAGGCAGG - Intergenic
1049505448 8:142994099-142994121 CTGAGCATGGGTTAGGAGGCTGG - Intergenic
1050282182 9:4061962-4061984 TAAAAAATGGGGAAGGTGGCAGG + Intronic
1050353719 9:4763539-4763561 AGGAAAAAGGGGGAGGAGGCAGG + Intergenic
1050433112 9:5582061-5582083 CAGAAGCGGGGGTAGGAGGAGGG + Intergenic
1050450677 9:5778794-5778816 TAGAAACTGAGGTAGGAGGATGG - Intronic
1050602040 9:7262596-7262618 CAGAAAAAAGGGAAGTAGGCAGG + Intergenic
1050620240 9:7444817-7444839 CAGAAACTCAGGTAGGAGCCAGG - Intergenic
1051331289 9:16027285-16027307 TAGAAAAGGGGGTTGGAGGGAGG - Intronic
1051437200 9:17045397-17045419 CAGATAATGAGGCAGGAGGAGGG - Intergenic
1051446326 9:17142990-17143012 CTGAAAATGGGGCAGCAGGGAGG + Intronic
1051765244 9:20515499-20515521 GAGAAAATGGGGGAGGAGGAAGG + Intronic
1052275211 9:26667519-26667541 TAGAAAATGAGATATGAGGCCGG - Intergenic
1052813544 9:33082625-33082647 GATAAAATGGGGAACGAGGCTGG - Intergenic
1053125100 9:35574727-35574749 AAGATAATGAGGTAGGAGGTGGG + Intergenic
1053164471 9:35834957-35834979 CAGACAATGGGGTGGGAGGCAGG - Intronic
1055042966 9:71895220-71895242 CTGTAAATGGGGTGGGAGGAGGG - Intronic
1056431865 9:86535705-86535727 CAGAAAATGTGCTAGGACGATGG + Intergenic
1056648159 9:88432896-88432918 AAGAAAATGGGGGAGGAAGAGGG - Intronic
1056918379 9:90763942-90763964 CAGGGAATGAGGTAAGAGGCAGG - Intergenic
1057483132 9:95461421-95461443 CAGAATTTGGGGTAGGTGGGTGG - Intronic
1057897489 9:98921436-98921458 CAGAAATTGATGTTGGAGGCTGG + Intergenic
1058453037 9:105114553-105114575 CAGAAGCTGGGGTGGGAGGGTGG + Intergenic
1059150778 9:111947934-111947956 CAGAAAAAGGGGGAGGAGCTTGG - Intergenic
1059883877 9:118722760-118722782 CAAAGTAGGGGGTAGGAGGCAGG - Intergenic
1060604985 9:124905622-124905644 CAGAAAATGGAATAAGAGGTGGG + Intronic
1185509070 X:649332-649354 CAGAAAAAGAGAGAGGAGGCCGG - Intronic
1185823594 X:3227753-3227775 CACAGAATGGGATAGGAGGCTGG + Intergenic
1186213998 X:7279843-7279865 CACAAAATGAGGTAAGATGCTGG - Intronic
1186452478 X:9685041-9685063 GAGCAGATGGGGTAGGAGGATGG + Intronic
1186900161 X:14045893-14045915 GAGAAAAAGGGGTTGGAGGCTGG + Intergenic
1187337924 X:18396899-18396921 CAGAAAATAGGCTAAGAGGGTGG - Intergenic
1187563835 X:20428618-20428640 TACAAAATGGGGTAGTAGGGGGG + Intergenic
1188229594 X:27645049-27645071 CATAAAATGAGTTAGGGGGCGGG - Intronic
1188501638 X:30833263-30833285 CTGAAAATGGCATAGTAGGCCGG - Intronic
1190301774 X:49061136-49061158 CAGAGAAGGAGGCAGGAGGCAGG + Intronic
1190553973 X:51615208-51615230 CAGAGAATAGGGTATGAGGTGGG + Intergenic
1190836135 X:54102323-54102345 CAGAAAATAGACTAAGAGGCAGG - Intronic
1190836870 X:54109322-54109344 CAGAAAATAGACTAAGAGGCAGG + Intronic
1190876590 X:54464627-54464649 GAGAAAGTGGGGTAGGCGGGGGG + Intronic
1190959026 X:55227250-55227272 CAGAAAATTGGGGAGGAGTGGGG + Intronic
1194570915 X:95553692-95553714 CAGAAAATGAGGTAGGAGGTGGG - Intergenic
1195436736 X:104852958-104852980 CAGAAAAAGGGGTATGAGCAGGG + Intronic
1196703695 X:118698389-118698411 CAGAGAAGTGGGTAGGAGGTGGG - Intergenic
1196769799 X:119282107-119282129 AAGAAAATGGAGAGGGAGGCCGG - Intergenic
1196934275 X:120714088-120714110 CAGAAAATGGGGAAGGCAGAAGG - Intergenic
1197728786 X:129793596-129793618 CAGAATATGGGGGTGGAGGTAGG - Intronic
1197929567 X:131680333-131680355 TAGGAAATGGGGTTGGAGCCGGG - Intergenic
1197945896 X:131840064-131840086 TAGGAAATGGGGTTGGAGCCGGG + Intergenic
1197954203 X:131929368-131929390 CAGAGCATGGGCTAGCAGGCCGG + Intergenic
1197988501 X:132292697-132292719 CTGAAAATGGGGTAGGGAGGGGG - Intergenic
1198007881 X:132517384-132517406 AAGCAAATGTGGTATGAGGCAGG + Intergenic
1198759814 X:140019435-140019457 CTCAAACTGAGGTAGGAGGCAGG - Intergenic
1198778971 X:140214615-140214637 CTCAAACTGAGGTAGGAGGCAGG + Intergenic
1199028289 X:142965549-142965571 CAGAAAATGAATTAGGAGGGGGG - Intergenic
1200209067 X:154337855-154337877 TAGAAAATGGGAAAGGAGCCAGG + Intergenic
1200221808 X:154394274-154394296 TAGAAAATGGGAAAGGAGCCAGG - Intronic
1201255822 Y:12107422-12107444 CACAGGATGGGATAGGAGGCTGG - Intergenic
1201431624 Y:13908546-13908568 GAGAAAATGGGGAAAGAGGAAGG - Intergenic
1201945183 Y:19503322-19503344 CAGAAATTGGTGTTGGAGGAAGG + Intergenic