ID: 1072102073

View in Genome Browser
Species Human (GRCh38)
Location 10:92239197-92239219
Sequence CCGAAGCCTCCAGTTCTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 82}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072102073_1072102079 -10 Left 1072102073 10:92239197-92239219 CCCTAAAGAACTGGAGGCTTCGG 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1072102079 10:92239210-92239232 GAGGCTTCGGAAGGGGAAAGAGG 0: 1
1: 0
2: 1
3: 24
4: 311
1072102073_1072102081 25 Left 1072102073 10:92239197-92239219 CCCTAAAGAACTGGAGGCTTCGG 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1072102081 10:92239245-92239267 CTGCCCTTTTTAAATATAAGCGG 0: 1
1: 0
2: 3
3: 7
4: 206
1072102073_1072102085 29 Left 1072102073 10:92239197-92239219 CCCTAAAGAACTGGAGGCTTCGG 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1072102085 10:92239249-92239271 CCTTTTTAAATATAAGCGGGTGG 0: 1
1: 0
2: 0
3: 6
4: 101
1072102073_1072102080 -4 Left 1072102073 10:92239197-92239219 CCCTAAAGAACTGGAGGCTTCGG 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1072102080 10:92239216-92239238 TCGGAAGGGGAAAGAGGAGCTGG 0: 1
1: 0
2: 7
3: 79
4: 725
1072102073_1072102082 26 Left 1072102073 10:92239197-92239219 CCCTAAAGAACTGGAGGCTTCGG 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1072102082 10:92239246-92239268 TGCCCTTTTTAAATATAAGCGGG 0: 1
1: 0
2: 0
3: 21
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072102073 Original CRISPR CCGAAGCCTCCAGTTCTTTA GGG (reversed) Intronic
903565595 1:24262947-24262969 TCTAAGCCTCCATTTCCTTATGG - Intergenic
904212530 1:28895419-28895441 CAGAATCCCACAGTTCTTTAGGG + Intronic
915620980 1:157084001-157084023 CTGAACCCTCCAGGTATTTATGG + Intergenic
916311621 1:163404918-163404940 CCAAAGCCTGCAGTTCTAGAAGG - Intergenic
917154480 1:171981983-171982005 CTGAAGCCTCAAGTTGTTTGAGG + Intronic
921634313 1:217475060-217475082 CCGAAGCCTTCAGTTATGTTAGG - Intronic
1064088536 10:12363935-12363957 CCCGTGCCTCCAGTTCTTTTGGG + Intronic
1066222340 10:33347363-33347385 CAGAATTCTCCAGTGCTTTAGGG - Intergenic
1066529785 10:36324733-36324755 CTAATGCCTCCAGTTCTATAAGG + Intergenic
1069647038 10:70007927-70007949 ATGATTCCTCCAGTTCTTTAAGG - Intergenic
1072102073 10:92239197-92239219 CCGAAGCCTCCAGTTCTTTAGGG - Intronic
1072221399 10:93330545-93330567 CCCTTGGCTCCAGTTCTTTAAGG + Intronic
1074579577 10:114705997-114706019 TCAAAGGATCCAGTTCTTTAGGG - Intergenic
1076551551 10:131281543-131281565 CCCAAGCCCCCAGATCCTTAGGG + Intronic
1082064521 11:47888799-47888821 CAGATGCGTCCAGTGCTTTATGG - Intergenic
1090278940 11:125439755-125439777 GGGAAGCCTCCTGTGCTTTATGG - Intergenic
1095724987 12:45441849-45441871 CCAAAGCCTGTATTTCTTTAGGG - Intergenic
1096974008 12:55688217-55688239 TCGGAGCATCAAGTTCTTTATGG + Exonic
1099352017 12:81583736-81583758 CCTAGGCCTCCAGATCTTTAGGG - Intronic
1100828015 12:98492859-98492881 CCTAAGCTTCCTGTCCTTTAAGG - Intronic
1106369919 13:29122219-29122241 CCAAAGCCTCCTGTCTTTTAAGG - Intronic
1112425807 13:99299998-99300020 CACAAGCCCTCAGTTCTTTAAGG - Intronic
1113091746 13:106624155-106624177 CCTCAGTCTCCAGTTCTGTAAGG + Intergenic
1113576642 13:111399738-111399760 CGGAACCGTCCAGTTCCTTAAGG - Intergenic
1115556336 14:34547476-34547498 CCAAAGTCTCCTGTTCTTGAGGG - Intergenic
1115557572 14:34555605-34555627 CCAAAGTCTCCTGTTCTTGAGGG + Intergenic
1116111569 14:40591848-40591870 CAGAAACCCCCAGTTTTTTAAGG - Intergenic
1120977740 14:90264470-90264492 TGGAAGCCTCCAGTGCTTTGTGG + Intronic
1124250284 15:28102447-28102469 CAGAAGCCACCAGTTCCTTAGGG + Intergenic
1124431667 15:29613800-29613822 CCCACGCCTCCAGTTCTTCATGG + Intergenic
1125158457 15:36616221-36616243 CAGAAGCATCCAGTTCTTAAAGG - Intronic
1127600567 15:60532119-60532141 GCGAACTCTCCAGTTCTTGAAGG - Intronic
1131552096 15:93365843-93365865 CCAAAGCCTCCTGTTCTTCTGGG - Intergenic
1136709441 16:32223755-32223777 CCTAAGCCTCTTGTTCTTTAGGG + Intergenic
1136758469 16:32705664-32705686 CCTAAGCCTCTTGTTCTTTAGGG - Intergenic
1136809639 16:33164715-33164737 CCTAAGCCTCTTGTTCTTTAGGG + Intergenic
1136816115 16:33274795-33274817 CCTAAGCCTCTTGTTCTTTAGGG + Intronic
1203060622 16_KI270728v1_random:965994-966016 CCTAAGCCTCTTGTTCTTTAGGG - Intergenic
1145772535 17:27504043-27504065 CCCAAGCATCCAGTATTTTATGG + Intronic
1151427873 17:74042942-74042964 GCGAAGCCTCCAGCTCTCCATGG - Intergenic
1158545812 18:58395499-58395521 CTGAAGCCTCCAGATATGTAGGG + Intronic
1160017584 18:75156486-75156508 CCAAAGCCTTCCTTTCTTTAGGG + Intergenic
1160212050 18:76889092-76889114 CAGAAACCTCCAGTTCAATATGG - Intronic
925729473 2:6907854-6907876 CTTAAGCCTCCTGTTCTCTAAGG - Intergenic
928954013 2:36842818-36842840 CAGAACACTCCAGTTCTCTAAGG - Intergenic
930294108 2:49531592-49531614 CCAAAGTCTCCTTTTCTTTAAGG - Intergenic
931626335 2:64259363-64259385 ACGAAGCCTCCAGCACTCTATGG - Intergenic
935217567 2:100986507-100986529 CCTTAGCCTGGAGTTCTTTAGGG - Intronic
937905118 2:127049353-127049375 CCTAAGCCCCCAGGTCTTCATGG - Intronic
938516537 2:132013176-132013198 ACGAAGTGTCCAGTTTTTTAGGG - Intergenic
938573622 2:132584600-132584622 GCCAAGTCTCCAGTTCTTTCAGG + Intronic
938784756 2:134616511-134616533 CCAAAACCCCCAGTTCTTTAGGG + Intronic
939896862 2:147801864-147801886 CAGAACCCTCATGTTCTTTAAGG - Intergenic
947032208 2:225809468-225809490 CCAACACCTTCAGTTCTTTAGGG - Intergenic
947409544 2:229821755-229821777 CAGAAGCCTATAGTGCTTTAGGG + Intronic
1175774876 20:61646724-61646746 CATCAGCCTCCAGTTCATTAAGG + Intronic
1179498993 21:41795041-41795063 CTGCAGCCTCCAGGTCTGTAGGG - Intergenic
1180638714 22:17281097-17281119 CCCAAGCCTTCAGTTCTGGAGGG - Intergenic
956541407 3:70344238-70344260 CCCAAGCCCCCAGTTCCATAAGG + Intergenic
961677349 3:128575885-128575907 CAGGAGCCTCCAGCTCTTTCTGG - Exonic
961930005 3:130523111-130523133 CCCAGTCCTCTAGTTCTTTAGGG + Intergenic
962206082 3:133434982-133435004 CCAAGGCCCTCAGTTCTTTAGGG - Intronic
964200048 3:154108846-154108868 CCCATGCCTCCATTTCTTTGTGG - Intergenic
966428285 3:179804656-179804678 CCGACACCTGCAGTTCTTGAGGG + Intronic
970818856 4:20190029-20190051 CTGAACCCTCCAAGTCTTTAGGG - Intergenic
972568540 4:40290097-40290119 CCAAAGCCTCCACCTCTGTAAGG - Intergenic
972825804 4:42757728-42757750 CCAAAGCTTCCAGTTTTTTCAGG + Intergenic
977874872 4:102137447-102137469 TCTGAGCCTCCATTTCTTTATGG + Intergenic
980477604 4:133337960-133337982 CTTGATCCTCCAGTTCTTTAAGG + Intergenic
984716435 4:182929884-182929906 CAGAAACCTCCAGTTCTTACTGG - Intergenic
986468123 5:8047430-8047452 CCAAAGCCTGAAGTTGTTTATGG - Intergenic
991578949 5:68134280-68134302 CCCAAGGCTTCAGTTCTTTCTGG + Intergenic
992102463 5:73420237-73420259 ACGAAGCTTCCCGTGCTTTAGGG - Intergenic
994894552 5:105685804-105685826 CTGAAGCCTGCGGTTCTTAAGGG - Intergenic
1002024677 5:176388865-176388887 TCGAAGCCTCCAGTCATTGAGGG + Exonic
1002051407 5:176573708-176573730 AAGAAGCCTCCAGCTCTGTAGGG + Intronic
1003227527 6:4219678-4219700 CTGAACCCTCCAAGTCTTTAGGG + Intergenic
1005505230 6:26463634-26463656 CTGCAGCCTCCAGGTCCTTAGGG - Intronic
1007352851 6:41286713-41286735 CCGAAGCCTCTAGGTCATTGTGG - Exonic
1015113309 6:129619020-129619042 CCGAACCCTCCACAGCTTTAGGG - Intronic
1016102715 6:140122440-140122462 TCCCAGCCTCCATTTCTTTATGG + Intergenic
1024228732 7:47347835-47347857 CCTCAGCCCCCATTTCTTTATGG + Intronic
1024792737 7:52985289-52985311 CCTAGGCCTCCAGTTCTGTGAGG - Intergenic
1040304655 8:46205798-46205820 CAGAAGCCACCAGTTCTGTCCGG + Intergenic
1046085325 8:109427225-109427247 ACATAGCCTCCAGTTCTTTTTGG - Intronic
1049244132 8:141552422-141552444 CCGAACCTGCCAGTTCCTTAGGG + Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057819020 9:98317099-98317121 CTGAAGCCCCCAGAGCTTTAGGG + Intronic
1059211811 9:112519685-112519707 CCAAATCCTTCAGTTCTTTGAGG + Intronic
1188701117 X:33265165-33265187 GCCAAGTCTACAGTTCTTTAGGG - Intronic
1189178072 X:38978145-38978167 TCCAAGCCTCCATTTCTTCATGG - Intergenic
1196254027 X:113494654-113494676 CCCAAGCCTCTAGCTCTTTCAGG + Intergenic
1199936077 X:152574907-152574929 CCTAAGCCTCTAGGTCTTGAGGG - Intergenic