ID: 1072111337

View in Genome Browser
Species Human (GRCh38)
Location 10:92323024-92323046
Sequence TAAAGAAGGTGGCTGGGGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 526
Summary {0: 1, 1: 0, 2: 5, 3: 54, 4: 466}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072111337_1072111343 7 Left 1072111337 10:92323024-92323046 CCGGTCCCCAGCCACCTTCTTTA 0: 1
1: 0
2: 5
3: 54
4: 466
Right 1072111343 10:92323054-92323076 TCAGTCTTGCCATGTTGCTCAGG No data
1072111337_1072111344 11 Left 1072111337 10:92323024-92323046 CCGGTCCCCAGCCACCTTCTTTA 0: 1
1: 0
2: 5
3: 54
4: 466
Right 1072111344 10:92323058-92323080 TCTTGCCATGTTGCTCAGGCTGG 0: 116
1: 2531
2: 20159
3: 80331
4: 203570

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072111337 Original CRISPR TAAAGAAGGTGGCTGGGGAC CGG (reversed) Intronic
900625692 1:3607574-3607596 TGGAGAAGGTGGCAGGGGAAGGG + Intronic
900692191 1:3987567-3987589 TAGAGGAGGTGGCTGGGGTTTGG + Intergenic
901063218 1:6483264-6483286 CCAGGCAGGTGGCTGGGGACAGG + Intronic
901320850 1:8339083-8339105 TAAAGATGGTGGCTGGCTACGGG + Intronic
901754749 1:11434743-11434765 GAGAGCAGGTGGCTGGGGCCTGG + Intergenic
901758037 1:11453290-11453312 TACAGAGGCTGGCTGGGGGCTGG - Intergenic
902110465 1:14074283-14074305 TGAAGAAAGGGGCTGGGGGCTGG - Intergenic
902438898 1:16416380-16416402 TAAAGAATGTGGTGGGGGCCGGG + Intronic
902807892 1:18872274-18872296 TAAGGTGTGTGGCTGGGGACAGG + Exonic
905171281 1:36111202-36111224 TGATGAGGGTGGCTGGGGAGGGG - Intronic
905357068 1:37392002-37392024 AGAGGAAGGGGGCTGGGGACTGG - Intergenic
905371832 1:37486583-37486605 TAGAGAAGTGGGATGGGGACTGG - Intergenic
905407249 1:37742410-37742432 AAAAGAAGTTAGCTGGGGACAGG + Intronic
905978849 1:42204284-42204306 TCAAGGAGGTGGGTGGGGAGGGG + Intronic
906662140 1:47590580-47590602 TAGAGAGGGAGGCTGGGGTCAGG + Intergenic
907518250 1:55006999-55007021 TACATAGGGCGGCTGGGGACTGG - Exonic
907626116 1:56031588-56031610 TAAAGTGGGTGGCAGGGGGCAGG - Intergenic
907813991 1:57900339-57900361 TAAAGAAGGCAGCAGGGGACAGG - Intronic
910216818 1:84851779-84851801 TAGAAAAGGAGGCTGGGAACAGG + Intronic
911095026 1:94048010-94048032 CAAATCAGGAGGCTGGGGACTGG - Intronic
911718118 1:101158874-101158896 CAAAGATAGTGTCTGGGGACTGG - Intergenic
912939094 1:114029440-114029462 TAAAGGAGGTGGTTGGGGTGTGG - Intergenic
914863694 1:151407711-151407733 TCAAGAATCTGGCTGGGGCCGGG + Intronic
915243511 1:154540771-154540793 GAGAGAAGGTGGATGGGGAGAGG + Intronic
915365322 1:155312037-155312059 GAAAGAATGTGCCTGGGTACTGG + Intronic
915918448 1:159956174-159956196 CAAAGAAGGAGGCTGGGCAAGGG + Intergenic
915971552 1:160358640-160358662 TCAGGAAGGTGGCTGGGTACAGG - Exonic
916060263 1:161093475-161093497 TAAAGGATGGGGCTGGGGGCTGG - Intergenic
916163584 1:161943662-161943684 TCAAGCAGGTGTCTGGGGAGAGG - Intronic
916737306 1:167619363-167619385 TAAAGAAAGTAGATGGGGCCGGG + Intergenic
919857472 1:201715547-201715569 TAGAGAATGAGGCTGGGGGCAGG + Intronic
920214358 1:204351352-204351374 TAGAGAAGGTGGGAGGGGTCGGG - Intronic
920754675 1:208717713-208717735 TAAAAAATGTGGCAGGGGGCGGG + Intergenic
921010563 1:211136627-211136649 TTGAGAATGTGGCTGTGGACAGG - Intergenic
921384413 1:214554003-214554025 TAAAGCCAGTGTCTGGGGACAGG + Intergenic
922132388 1:222792683-222792705 TAGAGAAGATGGTTGGGGTCTGG - Intergenic
922314431 1:224429977-224429999 TAAAGAACTTGCCTGTGGACTGG - Intronic
922634354 1:227151083-227151105 TAGAGAAGGATGGTGGGGACTGG - Intronic
923405231 1:233653017-233653039 TAAAGAAGGTGGCTGGGGGATGG - Intronic
923859444 1:237878317-237878339 TAAGGAAGCTGGCAGGTGACTGG - Exonic
1062969683 10:1637314-1637336 TAAAGAATGAAGCTGGTGACAGG - Intronic
1065913767 10:30334363-30334385 TAAACAATGTGGTTGGGGCCGGG + Intronic
1066681301 10:37938721-37938743 TAAAAAAGGTGGCTGTGCAAGGG + Intergenic
1067007532 10:42679128-42679150 TAAAGAAGTTAGCTAGGCACGGG + Intergenic
1067242551 10:44508825-44508847 TGGAGAAGGTGGCATGGGACAGG + Intergenic
1067479823 10:46587438-46587460 GAAAGGAGGTCACTGGGGACGGG + Intronic
1067614914 10:47754359-47754381 GAAAGGAGGTCACTGGGGACGGG - Intergenic
1068522090 10:58088030-58088052 TGAAGAATGTGGGTGGGGAGAGG - Intergenic
1069039629 10:63681938-63681960 TAAAGAATGTGTCTGAGGAATGG + Intergenic
1069478731 10:68760954-68760976 AAAAAAAGGTGGCGGGGGGCGGG - Intronic
1069509094 10:69027602-69027624 TAAAGAGTGTGGTTGGGGCCAGG - Intergenic
1069533343 10:69234965-69234987 TAAAGAAGGTTCCAGGGGCCTGG + Intronic
1070167297 10:73908561-73908583 TAAAAAATATGGCTGGGGCCGGG + Intergenic
1070489101 10:76959080-76959102 TAGAGAAGGTGGTTGGAGAGGGG - Intronic
1070812604 10:79305884-79305906 AAAAGCAAGTGGCTGGGCACAGG - Intronic
1071502331 10:86212655-86212677 TAATGAGGGTGGCTGGGGGCAGG - Intronic
1071601201 10:86959504-86959526 TAAGGATGGTGTCTGGGGGCCGG - Intronic
1071630319 10:87214323-87214345 GAAAGGAGGTCACTGGGGACGGG - Intergenic
1071704916 10:87987673-87987695 AAAAGAAGGTGGGTGGGGTGGGG + Intergenic
1072111337 10:92323024-92323046 TAAAGAAGGTGGCTGGGGACCGG - Intronic
1072198848 10:93140699-93140721 GAAAGAATGTGGCTGGGGAAGGG - Intergenic
1072421511 10:95293391-95293413 TAAAGCAGGTGGCTGGTTACTGG - Intergenic
1073345057 10:102776707-102776729 TGAAGAATGGGGCTGGGGAAGGG + Intronic
1074319468 10:112388369-112388391 TAGGGATGGTGGCTGGTGACAGG - Intronic
1075667223 10:124240006-124240028 GAAAGAAGGTAGCTGGCGGCAGG - Intergenic
1075687749 10:124376024-124376046 TAAAGATGGTGTCTGGGGGCCGG + Intergenic
1075928559 10:126273457-126273479 AAAAGATGGTGGGTGGGGAGGGG + Intronic
1076210008 10:128632683-128632705 ATAAGCAGGTGGCTGGGGTCTGG + Intergenic
1076902348 10:133346133-133346155 TAAAGAAGGTGGTCAGGGCCGGG + Intronic
1077038835 11:508469-508491 TAAAGAAGGTGGTTCTGGCCGGG + Intergenic
1077060073 11:614091-614113 TTTAGAAGGGGGCTGGGGATTGG - Intronic
1077202355 11:1317081-1317103 CAAAGAAGGTGGCTGGGTGCAGG - Intergenic
1077225079 11:1436127-1436149 TGATGAAGGTGGGTGGGGCCGGG + Exonic
1077394171 11:2313062-2313084 TGAAGAAGGTGGAAGGTGACGGG - Intronic
1077523260 11:3048842-3048864 TAAGGAGGGAGGCTGGGGCCTGG - Intronic
1079079033 11:17401295-17401317 CAAAGAAGCTTGCTGGGGACTGG - Intronic
1079372694 11:19865009-19865031 TTTTGAAGGGGGCTGGGGACTGG - Intronic
1080530341 11:33169153-33169175 TCAAGCAGTTGGCTGGGGTCAGG - Intergenic
1080716753 11:34809925-34809947 TAAAAAAGGTTGTTGGGGACAGG + Intergenic
1081537904 11:44008566-44008588 TTAAGAAGATGGCTTGGGACCGG + Intergenic
1081613496 11:44577366-44577388 GGAAGAAGGTGGCTGGAGCCAGG - Intronic
1082176699 11:49068468-49068490 CAGAGCAGGAGGCTGGGGACAGG - Intergenic
1082779661 11:57276979-57277001 TCAAGCTGGTGGCTGGGGAGTGG + Intergenic
1083115236 11:60452537-60452559 TAAAGAGGGTGGCTTGGGGAAGG + Intronic
1083660764 11:64250948-64250970 TAAAGGAGGTGGCAGGCGCCCGG + Intergenic
1083716657 11:64581386-64581408 TCAAGAAGGTGGCCAGGGCCAGG - Intergenic
1084030493 11:66477941-66477963 TAGGGAAGGTTGCTGGGGCCTGG + Intergenic
1084319661 11:68366261-68366283 TGCAGAAGGTGGTGGGGGACAGG + Intronic
1085121441 11:73969972-73969994 TCAAGAAGGTGCCAGGGGAGGGG + Exonic
1085329550 11:75636616-75636638 TAAAGGAGGTGGTTGGGGAATGG - Intronic
1085365943 11:75944738-75944760 TAAATAAGATCTCTGGGGACTGG + Intronic
1085793500 11:79516484-79516506 TCAAGAAGGTGGGAGGGGAGGGG - Intergenic
1086689006 11:89767409-89767431 CAGAGCAGGAGGCTGGGGACAGG + Intergenic
1086716850 11:90072551-90072573 CAGAGCAGGAGGCTGGGGACAGG - Intergenic
1086981145 11:93198585-93198607 TAAGTAACGTGTCTGGGGACAGG + Intergenic
1087069877 11:94067659-94067681 TAAGGAAGGTGGCTGGGAACAGG - Exonic
1087505083 11:99010517-99010539 TAAAAAATGTGGCTGGGCAAGGG - Intergenic
1088190554 11:107223485-107223507 TAGAGAATGTGGCTGTGGATTGG - Intergenic
1089802820 11:121050585-121050607 AAAAGAAGGTAGCTTGGGAAAGG - Intronic
1090292182 11:125555025-125555047 AAAAAAAGGTGGCGGGGGGCGGG + Intergenic
1090496137 11:127214611-127214633 TAAAGAAGTTGGCAGGGGTGAGG - Intergenic
1091047874 11:132341114-132341136 TGAAGAGGGTGGTTGGGCACAGG - Intergenic
1091668927 12:2438618-2438640 CACAGAATGTGGCTGGGGAACGG + Intronic
1091796269 12:3299069-3299091 AGAAGAAGGTGGCGGGGGGCAGG - Intergenic
1091919556 12:4293556-4293578 TTAAGAATGTGTCTAGGGACAGG - Intronic
1091992156 12:4964120-4964142 AAACGAAGGTGGCTAGGGTCAGG - Intergenic
1092128991 12:6095445-6095467 TGCAGAAGGTGGGTGTGGACTGG - Exonic
1092405261 12:8217343-8217365 TCATGAAGGTGGGTGGGGGCTGG + Intergenic
1092654870 12:10673903-10673925 TAAAGAAGGTGGGAAGGGAATGG - Intronic
1092942842 12:13426655-13426677 TAAATAAGGGTGCAGGGGACAGG - Intergenic
1093295409 12:17383906-17383928 TCAAGAAAGTGGCTGGGGTTTGG + Intergenic
1094058640 12:26290687-26290709 GAAAGAATGTGCCTGGGGAGAGG + Intronic
1096501645 12:52067569-52067591 AAAAGAAAGTGACTGGGGAGAGG - Intergenic
1097054978 12:56243770-56243792 TGAAGAAGGTGGGTGGGGTCTGG - Exonic
1097307310 12:58083766-58083788 TAAAGATGGTGGCTTGGGAATGG + Intergenic
1098279824 12:68851314-68851336 TAAAGAAAGTGGCTGGGCGCGGG + Exonic
1098797063 12:74903006-74903028 TAAAGAAGGAGACTGGAGATCGG - Intergenic
1100185346 12:92133009-92133031 AGAAGAAGGTGTGTGGGGACAGG + Intronic
1101871167 12:108566627-108566649 TAAAGAGGATGCCTGGGGTCTGG - Intronic
1101899868 12:108783802-108783824 CAAAACAAGTGGCTGGGGACAGG + Exonic
1102057917 12:109910585-109910607 TAATGCAGGAGGCTGGGCACTGG - Intronic
1102177669 12:110887888-110887910 TAAAAAAGAAGGCTGGGGCCGGG - Intronic
1102546982 12:113664395-113664417 GAAAGAAGGTGGCAGGGAGCAGG + Intergenic
1104971729 12:132533868-132533890 GAAGGAAGGTGGCCGGGGTCAGG + Intronic
1105803950 13:23938798-23938820 AAAAGAAGGTGGCCAGGGAGAGG - Intergenic
1106663523 13:31827158-31827180 GAAAGAAGCTGGGTGGAGACAGG + Intergenic
1107161210 13:37230250-37230272 TAAAGAAGTGGGCTGGGCTCTGG + Intergenic
1107441661 13:40433097-40433119 TCAAGAAGGTGGGAGGGGAAGGG + Intergenic
1108071707 13:46635452-46635474 AAAAAAAGGTGGGAGGGGACCGG - Intronic
1109083755 13:57942949-57942971 CAAATAAGGTGGCGGGGGGCGGG - Intergenic
1109853990 13:68105190-68105212 GAAAGAAGGTGGCTTGGAGCAGG - Intergenic
1113040250 13:106097023-106097045 TATTGATGGTGGCGGGGGACAGG + Intergenic
1113267841 13:108639225-108639247 TAAATCAGGAGGGTGGGGACAGG + Intronic
1113596192 13:111535285-111535307 TAAAGAAGGTGGGCGGGGAGGGG - Intergenic
1113981980 13:114283854-114283876 GGAAGAGGGTGGCTGGGGAGGGG - Intronic
1114450130 14:22819903-22819925 TAGAGAAGGTGCCTGGAGGCGGG - Intronic
1115771911 14:36672585-36672607 TAATGAAGGTGGCAGGAGGCAGG + Intronic
1117157341 14:52953513-52953535 AAAAAAAGGTGGGTGGGGATTGG + Intergenic
1117684657 14:58240829-58240851 TAGAGACGGTAGTTGGGGACGGG - Intronic
1118472075 14:66083445-66083467 GAAAGGTGGTGGCGGGGGACTGG + Intergenic
1118709887 14:68510368-68510390 TAGAGTAGGAGGCTGGGGGCGGG + Intronic
1119184575 14:72630870-72630892 TAAAGAAGGATGCTAGAGACAGG + Intronic
1119711194 14:76823625-76823647 TAAAAAATGTGGCTGGGGTCAGG + Intronic
1119778541 14:77263062-77263084 TCAAGAAGGTGGCTAGATACAGG + Intergenic
1120369169 14:83610097-83610119 TAAAGGAGATGGCTGGAGAGTGG + Intergenic
1121615645 14:95311808-95311830 TGAAGAAGGTGGCAGAGGATGGG - Intronic
1121825821 14:97008621-97008643 TTAAGCAGGTGGATGGGCACTGG - Intergenic
1122192188 14:100054489-100054511 TAAAGGAAGTGGCTGGGGTATGG - Intronic
1122703783 14:103607758-103607780 GAAAGAAGATGGGTGGGGGCGGG - Intronic
1122740638 14:103869837-103869859 GAAAGGGTGTGGCTGGGGACAGG - Intergenic
1124341347 15:28891243-28891265 GCAACAAGGAGGCTGGGGACAGG + Intronic
1125294915 15:38192081-38192103 TAAAGGGGAAGGCTGGGGACAGG - Intergenic
1125491067 15:40148767-40148789 TCAAGATGGTGGGTGAGGACCGG + Intergenic
1127387904 15:58482195-58482217 GAAACTGGGTGGCTGGGGACAGG - Intronic
1127905241 15:63371492-63371514 GAAAGAAGGTGGCCTGGCACGGG - Intronic
1128073987 15:64814784-64814806 TAAAAAAGGTGGCTGGGGCCGGG - Intergenic
1128488971 15:68126816-68126838 AAAAAAAGGTAGCTGGGAACAGG - Intronic
1128661774 15:69506593-69506615 TAGAGAAGAAGGCTGGGGGCTGG - Intergenic
1129014141 15:72450962-72450984 CAAGGAAGCTGGCTAGGGACAGG - Intergenic
1130577729 15:85107175-85107197 CGAAGAAGGTGGCAGGGGAGAGG + Intronic
1131046000 15:89316057-89316079 TAAAGAGAGTGGATGGGGCCAGG - Intronic
1131419718 15:92295143-92295165 TGAAGAAGGTGACTGGGGCGTGG + Intergenic
1131507569 15:93031090-93031112 GGATGAAGGAGGCTGGGGACGGG - Intergenic
1133028172 16:2997613-2997635 TACAGAAGGGGGCTGGAGCCTGG - Intergenic
1133272406 16:4616629-4616651 CAACGAAGGAGGCTGGGGCCAGG - Intronic
1133345177 16:5065184-5065206 CCAAGAAGGGGGCTGGAGACAGG - Intronic
1133569142 16:7024610-7024632 CAAAGATGGTGGCAGGGGAGTGG - Intronic
1133641448 16:7721197-7721219 GAAATAAGGTGGCTGAGGGCTGG - Intergenic
1133918005 16:10126452-10126474 TAATGAAACTGGCTGGGCACTGG - Intronic
1135023534 16:18982200-18982222 AAAAAAAGGAGGCTGGAGACTGG - Intergenic
1135646317 16:24165330-24165352 AATAGAATGTGGCTGGGCACAGG - Intronic
1137063728 16:35814944-35814966 TAAAGAGGATGCCTGGGGAGAGG - Intergenic
1138006695 16:53343821-53343843 GAGGCAAGGTGGCTGGGGACAGG - Intergenic
1138238141 16:55402928-55402950 TAAAGAAGGTAGTTGGAGAAGGG - Intronic
1138363378 16:56451719-56451741 AAAAGCAGGTGGCTGAGGCCTGG + Exonic
1139453882 16:67055650-67055672 TAAAGAAAGTGTCTGGAGGCCGG - Intronic
1139508994 16:67415883-67415905 TAAGGAAGGGGGCTGGGAAGCGG - Intronic
1139805567 16:69563031-69563053 CAAAGAAGGTGTCTTGGGCCAGG + Intergenic
1140277749 16:73526010-73526032 AAAAGAAGGTGGTTGGGGACGGG + Intergenic
1140531394 16:75669788-75669810 AAAAGAATGTGGCTGGTGACTGG - Intronic
1140775670 16:78247112-78247134 AAAAAAAGGGGGCTGGGGAAGGG - Intronic
1141810570 16:86372821-86372843 AAAGGAAGGTGGAGGGGGACTGG + Intergenic
1141959433 16:87394575-87394597 TAAAGAAACTGGGTGGGGCCTGG + Intronic
1142638733 17:1272711-1272733 TAAGGGCTGTGGCTGGGGACAGG - Intergenic
1143053780 17:4147556-4147578 TAAAGAACGTGGCAGTGGCCAGG + Intronic
1143149345 17:4797858-4797880 AAAAGAAAATGGCTGGGGAGAGG - Intronic
1143712600 17:8744756-8744778 CACAGAAGGTGGCTGGAGACAGG + Exonic
1143769741 17:9161105-9161127 TAAAGAAGAAGGCAGGTGACAGG + Intronic
1144134169 17:12277369-12277391 TCAAGAAGGTTGCTGGGGAAGGG + Intergenic
1144285150 17:13766964-13766986 TAAAGAAGGTGGTTGGGGGTAGG + Intergenic
1146686339 17:34844010-34844032 TAAAGAAGGTGGTTGGGGTAGGG + Intergenic
1147498215 17:40937606-40937628 TAAAGAAGCAGTCTGGGGGCGGG + Intronic
1147505481 17:41012527-41012549 TACAGAAGGTGGCAGGTGGCAGG + Intronic
1147505491 17:41012589-41012611 TACAGAAGGTGGCAGGTGGCAGG + Intronic
1147505503 17:41012658-41012680 TACAGAAGGTGGCAGGTGGCAGG + Intronic
1147505513 17:41012720-41012742 TACAGAAGGTGGCAGGTGGCAGG + Intronic
1147571698 17:41575540-41575562 TGGAGAAGGTGGGTGAGGACAGG - Intergenic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1149304982 17:55339210-55339232 TCAAGATTGTGGCTGGGTACAGG + Intergenic
1149592471 17:57841602-57841624 TTAAAAATGTGGCTGGGGACAGG - Intronic
1150233568 17:63573887-63573909 TCAAGGAGGTGGCTGGAGGCAGG - Intronic
1151267486 17:72967988-72968010 AGAAGAAGGAGGCTGGGGTCTGG - Intronic
1151640910 17:75393489-75393511 GAAAGAAGGTGGGTGAGCACAGG + Intronic
1152021823 17:77783821-77783843 TGGACATGGTGGCTGGGGACTGG + Intergenic
1152582478 17:81172480-81172502 TCAAGAAGGTTGCTGGGGCCAGG + Intergenic
1152621648 17:81367883-81367905 AAAAAAAGGAGGCTGGGCACGGG - Intergenic
1152712832 17:81882892-81882914 TAAAAATGCTGGCTGGGGACAGG + Intergenic
1152841770 17:82573889-82573911 TAAAGAGGGTGGCTGGATAAAGG + Intronic
1152866440 17:82726550-82726572 TGGAGAAGGAGTCTGGGGACAGG + Exonic
1154315065 18:13297895-13297917 TAAGGCATGTGGCTGGGGCCAGG + Intronic
1154991427 18:21601207-21601229 TAAAGAAGGAGGGTGGGGCCGGG + Intergenic
1155284575 18:24274610-24274632 TTTAGAAGGTGGCTGAGGCCAGG + Intronic
1155887553 18:31226409-31226431 TATAAAAGGTAGTTGGGGACTGG + Intergenic
1156219488 18:35037467-35037489 TAAAGAGGGGGCCTGGGGCCTGG - Intronic
1156886574 18:42141850-42141872 TAAGGATGGTGGCAGGGGAGGGG + Intergenic
1157416481 18:47507663-47507685 TATAGAAGGAGGGTGGGGAGGGG + Intergenic
1157551108 18:48582407-48582429 TAAAGGAGGTGCCTGGGAATGGG + Intronic
1157847429 18:51017144-51017166 TAAAGATGGAGGCAGGAGACAGG + Intronic
1158650599 18:59281181-59281203 GAAAGATGGTTGCTGGGGGCTGG - Intronic
1159070786 18:63621687-63621709 CTAAGAAGGTGGCTGAGGACAGG - Intergenic
1159450880 18:68600402-68600424 TGAAAATGGTGGCTGGGGAGAGG - Intergenic
1159753790 18:72337575-72337597 TGAAGAAGGTGGATGTGAACTGG + Intergenic
1160059462 18:75516159-75516181 TAAGGCCAGTGGCTGGGGACAGG + Intergenic
1160083594 18:75753881-75753903 TATAGATGGTGGCAAGGGACAGG - Intergenic
1160301599 18:77686696-77686718 TGGAGAATGAGGCTGGGGACAGG - Intergenic
1162392323 19:10397007-10397029 TCAGGAAGGTGGTTGGGGAAGGG - Intronic
1163000719 19:14365023-14365045 AAAAGATGGTGGCTGGGAAATGG + Intergenic
1163190975 19:15676228-15676250 TATTGATGGTGGCTGGGGTCTGG + Intronic
1163732289 19:18956019-18956041 TTGAGAAGGTGGATGGGGCCAGG + Intergenic
1164005625 19:21145845-21145867 GAAAGAAGGTGGGAGGGGAATGG + Intronic
1164183059 19:22836504-22836526 GAAAGAAGGTGGTAGGGGAATGG + Intergenic
1164306597 19:24009361-24009383 GAAAGAAGGTGGGAGGGGAATGG - Intergenic
1164554635 19:29241794-29241816 GAAAGAAGGAGGCTGGGTGCCGG - Intergenic
1164907420 19:31978649-31978671 TATAGGAGGGGGCTGGGGGCTGG - Intergenic
1165039534 19:33059258-33059280 TGAAGAAGTTGGGTGGGGAATGG - Intronic
1165766160 19:38352488-38352510 CACTGAAGGTGGCTGGGGGCTGG + Intronic
1166305563 19:41935220-41935242 TAGAGAAGTGGGCTGGGGTCAGG + Intergenic
1166387538 19:42390480-42390502 AAAAGAAGGTGGCGGGGGGTGGG + Intergenic
1166504111 19:43360972-43360994 CAAAGACGGAGGCTGGGGCCTGG - Intronic
1166506346 19:43373786-43373808 CAAAGACGGAGGCTGGGGCCTGG + Intergenic
1166558747 19:43718524-43718546 TTCAGAGGGTGGCGGGGGACAGG - Exonic
1166560402 19:43729057-43729079 TAAAGGGGGTGGCGGGTGACCGG + Exonic
1167510616 19:49893691-49893713 TAAAGAAGGGAGTTGGGGCCGGG + Intronic
1168143133 19:54402986-54403008 AAATGGAGGTGGCTGGGGGCTGG - Intergenic
1168239351 19:55081502-55081524 TAAGGAAGGGGTCTGGGGGCAGG + Intronic
1168295931 19:55377338-55377360 TGAAGGAGGGGGCTGGGGCCTGG + Intronic
1168295957 19:55377407-55377429 TGAAGGAGGGGGCTGGGGCCTGG + Intronic
1168348786 19:55663916-55663938 TAGAGAAGGTGCCTAGGGCCGGG + Intronic
1202646015 1_KI270706v1_random:142578-142600 TAAAGAAGTTAGCTGGGCATAGG + Intergenic
925281860 2:2690520-2690542 TTAGCAAGGTGGCTGTGGACAGG - Intergenic
926101489 2:10121268-10121290 TAAAGAGGGTGGGGTGGGACAGG - Intergenic
926347117 2:11957570-11957592 TACAGAGGGAGGCTGGAGACAGG + Intergenic
927928028 2:27026559-27026581 TAAATAGGGTGGGTGTGGACAGG - Exonic
928087776 2:28356508-28356530 AGGAGAGGGTGGCTGGGGACTGG + Intergenic
928197516 2:29226181-29226203 TAAAGGAGGAGGATGGGGCCAGG + Intronic
929240342 2:39647282-39647304 TAAAGGAGGTGATTGGGGCCTGG + Intergenic
929874844 2:45787781-45787803 TAAAGAAAGTGTCTGGGTAGTGG + Intronic
930560342 2:52952342-52952364 TCAGGCAGGTGGCTGGTGACAGG - Intergenic
930614403 2:53578603-53578625 TGAAGAAGGTGGCTTGGGAATGG + Intronic
930662902 2:54072857-54072879 TAAAAAAGGTAGCTGGGGGCTGG - Intronic
931443105 2:62305175-62305197 TAAGGCAGGTGGCAGGGGAGAGG - Intergenic
934733266 2:96672827-96672849 GAAATCAGGTGGCTGGGGAGGGG - Intergenic
934747613 2:96769862-96769884 TCAAGAAGCTGCCTGGGGGCAGG + Intronic
935226977 2:101061299-101061321 ACAAGAAGGTGCCAGGGGACCGG + Intronic
937776346 2:125780984-125781006 TAAAGAAGGAGCCTGGAGCCAGG - Intergenic
939800103 2:146697847-146697869 GAAAAAAGGTGGCGGGGGGCGGG + Intergenic
939950848 2:148470263-148470285 GCAAGATGGTGGTTGGGGACTGG - Exonic
940808353 2:158213761-158213783 TAAAGAAAGTTTCTGGGAACAGG + Intronic
942633039 2:177972653-177972675 TAAAGAAGATGGGTGGGCAAAGG + Intronic
942961701 2:181837269-181837291 TAGAGAAGGTGGTTAGGGAAGGG + Intergenic
945188542 2:207164451-207164473 GAAAGATGGTGGGTGGGGGCGGG - Intronic
946207944 2:218124346-218124368 TAAAGTAGGTGGGTAGGCACCGG + Intergenic
946710229 2:222497842-222497864 TAGAGAAGGTGGTTGGAGAGGGG + Intronic
946899609 2:224359532-224359554 TAAAGGAGGTGGCTGGGTGTGGG - Intergenic
948768926 2:240237538-240237560 GAAAGAAGGTGGTGGGGGAGGGG - Intergenic
1169472600 20:5901135-5901157 CAGTGGAGGTGGCTGGGGACAGG + Intergenic
1170270551 20:14522833-14522855 TAAATAAGGTCACTGAGGACAGG + Intronic
1170636137 20:18106190-18106212 TAAAGGAGGTGGTTGGGGTATGG + Intergenic
1170668696 20:18409772-18409794 CAAAGAAGGTGGGTGAGGCCAGG + Intronic
1170821320 20:19758080-19758102 TCAGGAAGGTGGCTGGGGGAGGG + Intergenic
1171160920 20:22922348-22922370 TAAAGACAGTGGTTGGGGACTGG + Intergenic
1171895987 20:30761497-30761519 TAAAGAAGTTAGCTGGGCATAGG + Intergenic
1172407632 20:34701424-34701446 TAAGAAGGGTGGCTGGGGGCTGG - Intronic
1173405885 20:42764299-42764321 TAAAGAATGTGGCTAGGAAGGGG + Intronic
1173719196 20:45238540-45238562 TAAGGCAGGTGGCTGAGCACAGG - Intergenic
1175216268 20:57392965-57392987 CAAAGAAGGGGGCGGGGGGCAGG + Intronic
1175351896 20:58328465-58328487 TAAAGAATGTAGCTGGACACTGG - Intronic
1175598313 20:60253147-60253169 GAAAGAAGCTGGCTGGAGAAGGG - Intergenic
1175748248 20:61476772-61476794 GAAAGGACATGGCTGGGGACAGG + Intronic
1175757519 20:61538949-61538971 TACAGGAGGTGGCTTGGGCCTGG + Intronic
1175780020 20:61676410-61676432 AAAAGAAGGTGGATGGGGGAGGG + Intronic
1176389110 21:6154584-6154606 GAAAGAAGGAGGCTGGGGGCTGG - Intergenic
1176605864 21:8830169-8830191 TAAAGAAGTTAGCTGGGAATAGG - Intergenic
1178636521 21:34308528-34308550 TAATGAGGGTGGGTGGGGGCAGG + Intergenic
1179034024 21:37744557-37744579 GAAAGATGGTGTTTGGGGACAGG - Intronic
1179181765 21:39051360-39051382 GAACCAAGGTGGCAGGGGACAGG - Intergenic
1179601419 21:42480165-42480187 AAAAGAGGGTGGCTGAGGTCAGG + Intronic
1179670176 21:42941418-42941440 TAAAGAAGCCGGCTAGGGCCGGG + Intergenic
1179734362 21:43383664-43383686 GAAAGAAGGAGGCTGGGGGCTGG + Intergenic
1180348162 22:11721775-11721797 TAAAGAAGTTAGCTGGGAATAGG - Intergenic
1180355936 22:11839871-11839893 TAAAGAAGTTAGCTGGGCATAGG - Intergenic
1180382320 22:12152455-12152477 TAAAGAAGTTAGCTGGGCATAGG + Intergenic
1180801162 22:18632593-18632615 TACAGTAGGAGGCTGGGGAGAGG - Intergenic
1180852391 22:19028152-19028174 TACAGTAGGAGGCTGGGGAGAGG - Intergenic
1181016805 22:20074818-20074840 TAAGAAATGTGGCTGGGGCCAGG - Intergenic
1181023351 22:20114634-20114656 TGGAGCATGTGGCTGGGGACCGG - Exonic
1181171029 22:21010195-21010217 TGAGGGAGGTGGGTGGGGACTGG - Intronic
1181220559 22:21362668-21362690 TACAGTAGGAGGCTGGGGAGAGG + Intergenic
1181466806 22:23114814-23114836 TCAACAAGGTGGGTGAGGACAGG - Intronic
1181902442 22:26168066-26168088 TAAAGAAGGTGGCTGAGGCAGGG - Intergenic
1182082609 22:27539801-27539823 GAAGGAAGGTCTCTGGGGACAGG + Intergenic
1182102624 22:27668833-27668855 TAAAGAGAGTGGGTGGGGGCAGG - Intergenic
1182102966 22:27670685-27670707 GAAAGAAGCAGGCTGGGGAAGGG - Intergenic
1182189390 22:28442938-28442960 TCAAGATGTTGGCTGGGGGCTGG + Intronic
1182460270 22:30478649-30478671 AAAAGATGGGGGCTGGGGGCAGG - Intergenic
1182926476 22:34129983-34130005 CCCAGATGGTGGCTGGGGACAGG - Intergenic
1183093332 22:35538438-35538460 TAAAGCAAGTGGGTGGGGAGGGG + Intergenic
1183422380 22:37719373-37719395 GAGAGCAGGTGGCTGGGGAGCGG + Intronic
1183543283 22:38442090-38442112 GAAAGCAGGTGGCTGGGGACAGG + Intronic
1185193075 22:49451207-49451229 AGAACAAGGTGGCTGGGGACTGG - Intronic
949414543 3:3800383-3800405 CAAGGAAGGTGGCGGGCGACGGG + Intronic
949575108 3:5331347-5331369 TAAAGAAGGTGCCTGCGGCCGGG - Intergenic
950339326 3:12228819-12228841 TAATGGAGGGGGTTGGGGACGGG + Intergenic
950414941 3:12863776-12863798 GTAAGAAGTGGGCTGGGGACAGG + Intronic
950466029 3:13154137-13154159 GCAAGAAGTGGGCTGGGGACAGG - Intergenic
951937249 3:28035315-28035337 TAAAGAAGGTGGGCAGGGAATGG + Intergenic
951964131 3:28363617-28363639 TAAAGGAGGTGGGTGGGGTGTGG - Intronic
954046966 3:47940236-47940258 TAATAATGGTGGCGGGGGACTGG - Intronic
954449577 3:50564406-50564428 GAAGGAAGGGGGCTGGGGAGAGG - Intronic
954675897 3:52315253-52315275 CCAAGAGGGAGGCTGGGGACAGG + Intergenic
954743768 3:52775059-52775081 TAGGGAAGGTGGCTGGGAAGGGG - Intergenic
955497783 3:59553766-59553788 GAAAGGAGGTGGATGGGGATAGG + Intergenic
956840716 3:73137408-73137430 TAAAGATGGTGTTTGGGGCCGGG + Intergenic
957375551 3:79352661-79352683 TAAAGAAGGCGGCTGGGTGGAGG - Intronic
959302290 3:104618723-104618745 TAAAGAAGGTGGTTGGAGTATGG - Intergenic
961655616 3:128439991-128440013 AAAAGAAGGTAGCTGGGGTGTGG + Intergenic
962053280 3:131841988-131842010 TAAAGAAGGAGGCAGAGGGCAGG - Intronic
963275599 3:143326634-143326656 TAGAGAAGGTAGTTGGGGAAGGG - Intronic
964436613 3:156659813-156659835 TTAAGAAGGTGGGAGGGGATGGG - Intergenic
964487896 3:157205289-157205311 CAGAGGAGGTGGGTGGGGACTGG - Intergenic
966696276 3:182793506-182793528 TAATGAAGGTGGCTGCGGCGCGG + Exonic
966947317 3:184785989-184786011 TGAAGAAGCTGGCTTGGGAGAGG - Intergenic
967131579 3:186475943-186475965 GATAGAAGGTTTCTGGGGACAGG + Intergenic
967183841 3:186929469-186929491 GGAAGAAGGGTGCTGGGGACAGG + Intergenic
967510506 3:190305634-190305656 TAGAGGAGGTGGCTTGGGACAGG - Intergenic
967829287 3:193904967-193904989 GAAAGAACCTGGCTGAGGACAGG - Intergenic
968957320 4:3725979-3726001 TAATGAAGGGGGCGGGGGAAGGG + Intergenic
969760853 4:9180628-9180650 TCATGAAGGTGGGTGGGGGCTGG - Intergenic
969909542 4:10430844-10430866 TGAAGCAGGTGGGTGGGGATGGG - Intergenic
970638306 4:18035180-18035202 TAGAGTAGGTGGCTCAGGACTGG + Intergenic
971257798 4:25030376-25030398 CAAAGAAGGGGCCTGGGGAGTGG + Intronic
973372243 4:49260813-49260835 TAAAGAAGTTAGCTGGGCATAGG + Intergenic
973388754 4:49534322-49534344 TAAAGAAGTTAGCTGGGCATAGG - Intergenic
973980283 4:56303046-56303068 TAAAGAAGGAGTCTGGAGGCTGG + Intronic
975723214 4:77268106-77268128 TAATGAAGGTGGCAGGGCACAGG + Intronic
978368764 4:108009256-108009278 AAAGGATGGTGGCTGGGGAGTGG + Intronic
978778841 4:112529079-112529101 CAAAAAAGGTGGATGGGGAGTGG - Intergenic
978879118 4:113679402-113679424 AAAAGAAAATGGCTGGGGAGAGG - Intronic
980995660 4:139777500-139777522 TAAAGCAGGTGTCTGGAGAATGG - Intronic
982375947 4:154690790-154690812 TAAGTAAGGTGGCAGGGTACAGG - Intronic
982525983 4:156478782-156478804 TGAAGATGGTGGATGGGGCCAGG + Intergenic
983064769 4:163195492-163195514 GCAAGAAGGTGTCTGGGAACAGG - Intergenic
985013088 4:185604471-185604493 GAAAGCAGGTGGCTGGGAAAGGG + Intronic
985025696 4:185737299-185737321 AAAGCAAAGTGGCTGGGGACAGG + Intronic
985567606 5:628369-628391 CAAAGAAGGGGGCTGGGTCCTGG - Intronic
985567641 5:628503-628525 CAAAGAAGGGGGCTGGGTCCTGG - Intronic
985567658 5:628570-628592 CAAAGAAGGGGGCTGGGTCCTGG - Intronic
985567677 5:628637-628659 CAAAGAAGGGGGCTGGGTCCTGG - Intronic
985567695 5:628704-628726 CAAAGAAGGGGGCTGGGTCCTGG - Intronic
985567747 5:628906-628928 CAAAGAAGGGGGCTGGGTCCTGG - Intronic
985567765 5:628974-628996 CAAAGAAGGGGGCTGGGTCCTGG - Intronic
986234991 5:5901069-5901091 TACAGAAGGTGGCAGTAGACGGG + Intergenic
986348667 5:6857189-6857211 TAATGAAGGTGGCAGGGGGTGGG + Intergenic
986737705 5:10680414-10680436 CAAAGAATGAGGCTGGAGACAGG - Exonic
986772618 5:10987714-10987736 AAAAGAAGGTGGAAGGGGAGGGG - Intronic
987750601 5:22034012-22034034 TAAAGAAAGTTGCTGGGGGAGGG + Intronic
987777502 5:22387452-22387474 TAACAAAGGTGGATAGGGACAGG - Intronic
989091327 5:37736106-37736128 AAAAGGAGCTGGCTGGGGAATGG + Intronic
993364795 5:87022215-87022237 TATAGTAGGTAGCTAGGGACAGG + Intergenic
993665411 5:90689317-90689339 AAAAAAAGGTGGGTGGGGAAAGG - Intronic
993669341 5:90741183-90741205 GGTAGAAGGTGGCTGGGGACTGG - Intronic
994076008 5:95650801-95650823 TAAAGAAGTTGGATAGGGCCGGG + Intronic
997006537 5:129823209-129823231 TAAAGATCTTGGCTGGGGAGTGG - Intergenic
997467790 5:134099876-134099898 TAAAGAAGGTAGTTGGGGCCAGG - Intergenic
997561270 5:134848014-134848036 TAAGAAATGTGGCTTGGGACCGG + Intronic
997910780 5:137870921-137870943 TGAGGAAGCTGGCTGGGGACTGG - Exonic
997992928 5:138561155-138561177 CAAAGATGGTGGCCGGGGGCGGG + Intronic
998021468 5:138774902-138774924 TAAAAAAGGTGGCACAGGACGGG - Intronic
999254924 5:150204906-150204928 CCAAGAGCGTGGCTGGGGACAGG - Exonic
999892923 5:155998830-155998852 AATGGAAGGTGGCTGGGAACTGG + Intronic
1001636081 5:173211361-173211383 CAAAGGAGGGGGCTGGGGGCTGG - Intergenic
1001755374 5:174164533-174164555 TAAAGAATGTGACTGTGGGCCGG - Intronic
1003320097 6:5043754-5043776 TAAAGGAGGTGGTTGGGGTGTGG - Intergenic
1003809793 6:9767268-9767290 TAAAAAATGTGACTGGGCACAGG + Intronic
1003955491 6:11161717-11161739 AAAAGAAGGTGGTGGGGGAGTGG + Intergenic
1004234705 6:13863996-13864018 TAAAGGAGGTGGCTGGTGTGTGG + Intergenic
1004493008 6:16135064-16135086 TACAGAAGAGGGCTGGGAACAGG - Intronic
1004506671 6:16252532-16252554 TAAAGAAGGTGGAGGGAGGCCGG - Intronic
1004620243 6:17325154-17325176 CAAAGAAGGTCACTGGGCACGGG - Intergenic
1006099427 6:31676901-31676923 TCAGGAAGGTGGCTGGAAACTGG + Exonic
1006644383 6:35505988-35506010 AGAAGAAGGTGGGTGGGGAGAGG - Exonic
1007634740 6:43292517-43292539 TGAAGGAGGTGGCTGGGGCTGGG + Intergenic
1009272106 6:61626956-61626978 TAAAGAATTTGGCTGGGGCCGGG + Intergenic
1010011824 6:71056561-71056583 TAGAGAATGTGACTGGGAACGGG - Intergenic
1010026255 6:71221033-71221055 GAAAGAAAGTGGGTGGGAACAGG + Intergenic
1010240773 6:73613820-73613842 TAAAAAATATGGCTGGGGGCTGG + Intronic
1010489687 6:76460775-76460797 TAAGGCAGGTGGGTGGAGACAGG - Intergenic
1011057789 6:83224526-83224548 TATAAAAAGTGGCTGGGGAGTGG + Intronic
1011704009 6:89983136-89983158 TAAAGAAGGAGGCAGAGGATGGG - Intronic
1012945571 6:105461970-105461992 TTAAGAAGGTGGGTGGGGGCAGG - Intergenic
1013109768 6:107055621-107055643 TAAAAGAGCTGGCTGGGGTCAGG + Intergenic
1013899384 6:115135002-115135024 TGAAGTAGGTGTCTGGGGATGGG - Intergenic
1014225595 6:118842807-118842829 TAAAAAAGGGGGCTCGGGAGTGG - Intronic
1015110011 6:129582057-129582079 TAAGGAAAGGGGCTGAGGACTGG + Intronic
1015526454 6:134178524-134178546 CAAAGAAAGAGGCTGGCGACAGG - Intronic
1016195425 6:141331390-141331412 TAAAGTATTTGGCTGGGGAAAGG - Intergenic
1016461266 6:144282552-144282574 TAAAGAAAGTGTTGGGGGACAGG + Intergenic
1016773678 6:147880589-147880611 TAAAGAATGTGGCTTTGGTCTGG + Intergenic
1016907845 6:149169198-149169220 CAAAGAAGGTGGTTGGGGTGTGG + Intergenic
1016999949 6:149989697-149989719 GCAAGAAGGTGCCTGGGAACAGG + Intergenic
1017035367 6:150262421-150262443 TGAAGAAGGAGGGTGGGGAAGGG - Intergenic
1017061468 6:150489002-150489024 AGAAGAGGGTGACTGGGGACAGG - Intergenic
1017180389 6:151546561-151546583 TGTAGGAGGTGGCTGGGGAGTGG - Intronic
1017263423 6:152414525-152414547 AAAAGATGGTGGCTGGGGGCAGG + Intronic
1017327845 6:153160076-153160098 TAATGCAAATGGCTGGGGACTGG - Intergenic
1019307327 7:342040-342062 TAAACAAGGGGGCGGGAGACAGG - Intergenic
1019380012 7:716350-716372 AAAAGAATGTGGCTTCGGACCGG - Intronic
1019623955 7:2006335-2006357 GAACGAAGGTGGCTGTGGCCTGG + Intronic
1021091153 7:16484656-16484678 GAAAGCAGGAGGCTTGGGACAGG - Intronic
1021126457 7:16855580-16855602 AAGAGAAGGGGGCTGGGGACAGG + Intergenic
1021800109 7:24296559-24296581 TAAAGATGGTGGATGCGGCCGGG + Intergenic
1021926077 7:25534924-25534946 AAAAAACGGTGGCTGGGGAGAGG + Intergenic
1022593762 7:31691623-31691645 GAAAGATGGAGGGTGGGGACGGG + Intronic
1022970983 7:35517138-35517160 TAGAGAAGGAGGCTAGGGATGGG - Intergenic
1025778868 7:64581903-64581925 GAAAGAAGGTGGAAGGGGAATGG + Intergenic
1026390090 7:69892084-69892106 TAAAGAAGATATCTGGGGCCAGG - Intronic
1027670929 7:81097433-81097455 TAAAGAAGGTAGCTACAGACTGG - Intergenic
1027864915 7:83633191-83633213 TAAAGAAGGGGGCATGGGAGAGG - Intronic
1029189150 7:98759730-98759752 GATAGAAGGTTGGTGGGGACTGG + Intergenic
1029217427 7:98961335-98961357 TACTGAGGATGGCTGGGGACTGG - Exonic
1029311230 7:99666896-99666918 TAAAGAATGAATCTGGGGACAGG - Intronic
1030133454 7:106222739-106222761 TCTAGGAAGTGGCTGGGGACAGG + Intergenic
1030817085 7:114051517-114051539 CCAAGAAGGTGGGTGGGGGCGGG + Intronic
1031861957 7:126990178-126990200 AGAAGAAGGTGGCTGGGGCCTGG - Intronic
1032067910 7:128785632-128785654 TCAGGAATTTGGCTGGGGACAGG - Intergenic
1032403269 7:131638337-131638359 TAGAGAGGGAGGCTGGGGAATGG - Intergenic
1033520508 7:142155668-142155690 TTAAGCAGGTGGCTGGGAGCAGG + Intronic
1033958822 7:146887042-146887064 TAAATAAGGAGACTGGGGAATGG - Intronic
1034315070 7:150123260-150123282 AAAAGAATGAGGCTGGGGCCTGG + Intergenic
1034791825 7:153977523-153977545 GAAAGAATGAGGCTGGGGCCTGG - Intronic
1035579709 8:731941-731963 TCCAGCAGGTGTCTGGGGACCGG - Intronic
1036270962 8:7302479-7302501 TCATGAAGGTGGGTGGGGGCTGG - Intergenic
1036350387 8:8007865-8007887 TCATGAAGGTGGGTGGGGGCTGG + Intergenic
1036668458 8:10764013-10764035 TAGAGATTGTGGCTGGTGACGGG - Intronic
1037583607 8:20261539-20261561 TGCAGAAGGGGGCTGGGGATGGG - Intronic
1037723659 8:21466057-21466079 TAAAGAGGGTGTGTGGGGACAGG + Intergenic
1037750555 8:21679404-21679426 TGAAGAAGATGGCTCAGGACAGG + Intergenic
1037856532 8:22375112-22375134 TAAGGAAGGTGGCAGGAGGCTGG - Intronic
1037939940 8:22943861-22943883 TAAAGGAGGTGGTTGGGGGTTGG - Intronic
1038041151 8:23725428-23725450 TGCAGAAGGTGGCTGGGGTGTGG + Intergenic
1038056183 8:23860106-23860128 TCACAAAGGTGTCTGGGGACAGG - Intergenic
1038449501 8:27630700-27630722 GAAGGAAGGTGGGTGGGGAGAGG - Intergenic
1038613335 8:29072534-29072556 TAAAGAACATGGCTGGGACCCGG + Intronic
1038620653 8:29139754-29139776 AAAAGAAGGTGCTGGGGGACAGG - Intronic
1040490851 8:47920961-47920983 TGAAAAATGTGGCTGGGCACGGG + Intronic
1040821170 8:51559335-51559357 GAAAGAAGGTGGCGGGGGGGGGG - Intronic
1041544488 8:59026420-59026442 TAAAAAAGGAGGCAGGGCACAGG + Intronic
1041727363 8:61030635-61030657 CCGAGAAGGTGGCTGTGGACAGG + Intergenic
1044792559 8:95863144-95863166 TAAAGGAGGTGGTTGGGGTATGG - Intergenic
1044842196 8:96346034-96346056 TCAAGAAGGAGGCTGTGGCCTGG + Intergenic
1045701915 8:104876588-104876610 GAACGAGGGTTGCTGGGGACTGG - Intronic
1046609008 8:116403603-116403625 TACATAAGGGGGCTGGGGGCTGG - Intergenic
1048033661 8:130656391-130656413 AAAAGCAAGTGGCTGGGGACAGG - Intergenic
1050070569 9:1808776-1808798 TGAAGAATGTTGCTGGGGGCTGG + Intergenic
1050114498 9:2249575-2249597 TAAAGATGGTGACTGTGGGCCGG - Intergenic
1050412093 9:5376876-5376898 TGAACCAGGTGGCTGGGGACAGG + Intronic
1050524073 9:6530341-6530363 AAAGCAAGGTGACTGGGGACAGG + Intergenic
1051140860 9:13977666-13977688 TTTATAAGGTGGTTGGGGACGGG + Intergenic
1051175227 9:14353525-14353547 GAATGAAGGGGGCTGGGGAGTGG + Intronic
1051224375 9:14883496-14883518 TCAAGAAGGTGGCATGGGAGGGG + Intronic
1051283570 9:15469617-15469639 AAAAGCAGGTGTTTGGGGACTGG - Intronic
1051407517 9:16754851-16754873 AAAACAAGATGGCTGGGGCCGGG - Intronic
1051639720 9:19213358-19213380 TAAAGAGGGTTCCTGGAGACAGG - Intergenic
1052916580 9:33927941-33927963 TGGAGAAGGTGGCTGAGGACTGG + Exonic
1054352653 9:64031282-64031304 TAAAGAAGTTAGCTGGGAATAGG - Intergenic
1055688550 9:78805000-78805022 CAAAGAAGTTGGCTGGAGGCTGG - Intergenic
1055796878 9:79984068-79984090 TAAAGAAGGTTGTTGTGAACTGG - Intergenic
1056221675 9:84456018-84456040 TAAAGAGGTGGGCTGGGGAAGGG + Intergenic
1056506596 9:87263707-87263729 GTAAGATGGTGGCTGGGCACTGG - Intergenic
1056759369 9:89404545-89404567 TGAGGCGGGTGGCTGGGGACGGG - Intronic
1056759385 9:89404593-89404615 TGAGGCGGGTGGCTGGGGACGGG - Intronic
1056759534 9:89405073-89405095 TGAGGCGGGTGGCTGGGGACAGG - Intronic
1056759592 9:89405265-89405287 TGAGGTGGGTGGCTGGGGACGGG - Intronic
1057504894 9:95625999-95626021 TAAAGTTGGTGTATGGGGACGGG + Intergenic
1057547600 9:96029938-96029960 TAGAGGAGGTGGCTGGTGTCCGG - Intergenic
1057888616 9:98851068-98851090 TAAAGAAGGGGGCGGGGGGCGGG - Intergenic
1058419532 9:104820751-104820773 TAAGGAGGGTGGCGGGGGAGAGG + Intronic
1058930970 9:109718360-109718382 AAAAGAAGGTAACTGGGGCCGGG - Intronic
1059027999 9:110657911-110657933 TAAAGAAGGAGGAAGAGGACAGG + Intergenic
1059338157 9:113581958-113581980 CAGAGAAGGTGGCTGGGCAAGGG - Intronic
1061928959 9:133822427-133822449 TGAAGAAGCCGGCTGGGAACTGG + Intronic
1203741001 Un_GL000218v1:377-399 TAAAGAAGTTAGCTGGGCATAGG - Intergenic
1203553258 Un_KI270743v1:182187-182209 TAAAGAAGTTAGCTGGGCATAGG - Intergenic
1185726485 X:2426032-2426054 TAAAGGAGATGGCTGGGGGGTGG + Intronic
1185739070 X:2515990-2516012 GAATGATGGTGACTGGGGACTGG - Intergenic
1186136271 X:6525198-6525220 TAAAGAAGGTGTCTTGTGACTGG - Intergenic
1186573827 X:10744329-10744351 TAATGAAGGTGGCTGGGATTAGG + Intronic
1187379000 X:18783277-18783299 TAAAGAAGGTAGCTGGGGTGTGG + Intronic
1187445803 X:19359935-19359957 CCAAAAAGGTGGCTGGGGGCAGG - Exonic
1187572454 X:20518847-20518869 TAAAGAAGGGCCCTGGGTACTGG - Intergenic
1189172261 X:38920512-38920534 TAAAAAAAGTGGCAGGGAACAGG - Intergenic
1189323630 X:40100377-40100399 GATAGAAGGTGGCTGGGCGCCGG - Intronic
1189563066 X:42210669-42210691 TAAAGAAGCTGGGTGTGGCCGGG - Intergenic
1190810783 X:53881444-53881466 ACAAGAAGGTGGGTGGGGAGAGG - Intergenic
1190944279 X:55075472-55075494 TAAGGAAGGGGCCTGGGAACTGG + Intronic
1192044589 X:67658718-67658740 CAAAGAAGGTGACTTGGAACAGG - Intronic
1194662428 X:96641593-96641615 TAAAGAAGAATACTGGGGACTGG - Intergenic
1195112759 X:101664150-101664172 CAAAGAAGGTGGAGGAGGACAGG + Intergenic
1196768365 X:119270139-119270161 TAAGCACGGGGGCTGGGGACTGG + Intergenic
1197190535 X:123642592-123642614 TATAAAAGGTGGCTGGGGTGTGG + Intronic
1197212132 X:123836838-123836860 TGAAGAAGATAGCTGGGGCCAGG + Intergenic
1197267247 X:124388008-124388030 GAAAGCAGGTGGCAGGGGGCAGG + Intronic
1197415890 X:126172348-126172370 TTATGAAGGTGGCTTGGGAAAGG - Intergenic
1198647809 X:138828777-138828799 TAAAGCAGATGGCGGGGGAGGGG - Intronic
1201154528 Y:11117846-11117868 TAAAGAAGTTAGCTGGGCATAGG - Intergenic
1201416612 Y:13753551-13753573 GAAACAAGGTGACTGGGGACGGG - Intergenic