ID: 1072115499

View in Genome Browser
Species Human (GRCh38)
Location 10:92366736-92366758
Sequence CTGTGTGTGCAGAGACACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072115495_1072115499 10 Left 1072115495 10:92366703-92366725 CCTTACTTTCTCCAAAACAAATG No data
Right 1072115499 10:92366736-92366758 CTGTGTGTGCAGAGACACCTGGG No data
1072115497_1072115499 -1 Left 1072115497 10:92366714-92366736 CCAAAACAAATGGAGTCTTTCTC No data
Right 1072115499 10:92366736-92366758 CTGTGTGTGCAGAGACACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072115499 Original CRISPR CTGTGTGTGCAGAGACACCT GGG Intergenic
No off target data available for this crispr