ID: 1072122611

View in Genome Browser
Species Human (GRCh38)
Location 10:92417648-92417670
Sequence CCCGTCACTGGCACCTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072122611_1072122618 12 Left 1072122611 10:92417648-92417670 CCCACTGAGGTGCCAGTGACGGG No data
Right 1072122618 10:92417683-92417705 ATGTCCCTATCCTATGCTGAAGG No data
1072122611_1072122623 26 Left 1072122611 10:92417648-92417670 CCCACTGAGGTGCCAGTGACGGG No data
Right 1072122623 10:92417697-92417719 TGCTGAAGGAGAGGTACACCAGG No data
1072122611_1072122621 17 Left 1072122611 10:92417648-92417670 CCCACTGAGGTGCCAGTGACGGG No data
Right 1072122621 10:92417688-92417710 CCTATCCTATGCTGAAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072122611 Original CRISPR CCCGTCACTGGCACCTCAGT GGG (reversed) Intergenic