ID: 1072122614

View in Genome Browser
Species Human (GRCh38)
Location 10:92417660-92417682
Sequence CCAGGTACTGGACCCGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072122614_1072122618 0 Left 1072122614 10:92417660-92417682 CCAGTGACGGGTCCAGTACCTGG No data
Right 1072122618 10:92417683-92417705 ATGTCCCTATCCTATGCTGAAGG No data
1072122614_1072122621 5 Left 1072122614 10:92417660-92417682 CCAGTGACGGGTCCAGTACCTGG No data
Right 1072122621 10:92417688-92417710 CCTATCCTATGCTGAAGGAGAGG No data
1072122614_1072122624 22 Left 1072122614 10:92417660-92417682 CCAGTGACGGGTCCAGTACCTGG No data
Right 1072122624 10:92417705-92417727 GAGAGGTACACCAGGCACAGTGG No data
1072122614_1072122623 14 Left 1072122614 10:92417660-92417682 CCAGTGACGGGTCCAGTACCTGG No data
Right 1072122623 10:92417697-92417719 TGCTGAAGGAGAGGTACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072122614 Original CRISPR CCAGGTACTGGACCCGTCAC TGG (reversed) Intergenic