ID: 1072122615

View in Genome Browser
Species Human (GRCh38)
Location 10:92417660-92417682
Sequence CCAGTGACGGGTCCAGTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072122609_1072122615 -10 Left 1072122609 10:92417647-92417669 CCCCACTGAGGTGCCAGTGACGG No data
Right 1072122615 10:92417660-92417682 CCAGTGACGGGTCCAGTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072122615 Original CRISPR CCAGTGACGGGTCCAGTACC TGG Intergenic