ID: 1072122617

View in Genome Browser
Species Human (GRCh38)
Location 10:92417678-92417700
Sequence AGCATAGGATAGGGACATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072122617_1072122624 4 Left 1072122617 10:92417678-92417700 CCTGGATGTCCCTATCCTATGCT No data
Right 1072122624 10:92417705-92417727 GAGAGGTACACCAGGCACAGTGG No data
1072122617_1072122623 -4 Left 1072122617 10:92417678-92417700 CCTGGATGTCCCTATCCTATGCT No data
Right 1072122623 10:92417697-92417719 TGCTGAAGGAGAGGTACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072122617 Original CRISPR AGCATAGGATAGGGACATCC AGG (reversed) Intergenic