ID: 1072122623

View in Genome Browser
Species Human (GRCh38)
Location 10:92417697-92417719
Sequence TGCTGAAGGAGAGGTACACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072122617_1072122623 -4 Left 1072122617 10:92417678-92417700 CCTGGATGTCCCTATCCTATGCT No data
Right 1072122623 10:92417697-92417719 TGCTGAAGGAGAGGTACACCAGG No data
1072122614_1072122623 14 Left 1072122614 10:92417660-92417682 CCAGTGACGGGTCCAGTACCTGG No data
Right 1072122623 10:92417697-92417719 TGCTGAAGGAGAGGTACACCAGG No data
1072122616_1072122623 2 Left 1072122616 10:92417672-92417694 CCAGTACCTGGATGTCCCTATCC No data
Right 1072122623 10:92417697-92417719 TGCTGAAGGAGAGGTACACCAGG No data
1072122611_1072122623 26 Left 1072122611 10:92417648-92417670 CCCACTGAGGTGCCAGTGACGGG No data
Right 1072122623 10:92417697-92417719 TGCTGAAGGAGAGGTACACCAGG No data
1072122609_1072122623 27 Left 1072122609 10:92417647-92417669 CCCCACTGAGGTGCCAGTGACGG No data
Right 1072122623 10:92417697-92417719 TGCTGAAGGAGAGGTACACCAGG No data
1072122613_1072122623 25 Left 1072122613 10:92417649-92417671 CCACTGAGGTGCCAGTGACGGGT No data
Right 1072122623 10:92417697-92417719 TGCTGAAGGAGAGGTACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072122623 Original CRISPR TGCTGAAGGAGAGGTACACC AGG Intergenic