ID: 1072122964

View in Genome Browser
Species Human (GRCh38)
Location 10:92420191-92420213
Sequence CCGCGCGTACCTGGTCCCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 1, 2: 0, 3: 0, 4: 19}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072122964_1072122969 -6 Left 1072122964 10:92420191-92420213 CCGATGGGACCAGGTACGCGCGG 0: 1
1: 1
2: 0
3: 0
4: 19
Right 1072122969 10:92420208-92420230 GCGCGGCCGGGCAGCCCAACAGG 0: 1
1: 0
2: 2
3: 5
4: 128
1072122964_1072122973 12 Left 1072122964 10:92420191-92420213 CCGATGGGACCAGGTACGCGCGG 0: 1
1: 1
2: 0
3: 0
4: 19
Right 1072122973 10:92420226-92420248 ACAGGTGCCAGCCCCAGAAATGG 0: 1
1: 0
2: 0
3: 22
4: 236
1072122964_1072122979 24 Left 1072122964 10:92420191-92420213 CCGATGGGACCAGGTACGCGCGG 0: 1
1: 1
2: 0
3: 0
4: 19
Right 1072122979 10:92420238-92420260 CCCAGAAATGGGTTCCAACAGGG 0: 1
1: 0
2: 3
3: 21
4: 140
1072122964_1072122977 23 Left 1072122964 10:92420191-92420213 CCGATGGGACCAGGTACGCGCGG 0: 1
1: 1
2: 0
3: 0
4: 19
Right 1072122977 10:92420237-92420259 CCCCAGAAATGGGTTCCAACAGG 0: 1
1: 0
2: 0
3: 8
4: 91
1072122964_1072122974 13 Left 1072122964 10:92420191-92420213 CCGATGGGACCAGGTACGCGCGG 0: 1
1: 1
2: 0
3: 0
4: 19
Right 1072122974 10:92420227-92420249 CAGGTGCCAGCCCCAGAAATGGG 0: 1
1: 0
2: 0
3: 25
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072122964 Original CRISPR CCGCGCGTACCTGGTCCCAT CGG (reversed) Intergenic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
906525249 1:46489865-46489887 CCGCTCGTACCTGGTCACCCCGG - Intergenic
1071875343 10:89837831-89837853 CCGCGCGTACCTTGTCCCATCGG + Intergenic
1072122964 10:92420191-92420213 CCGCGCGTACCTGGTCCCATCGG - Intergenic
1078465534 11:11547412-11547434 CCCCGAGTGCCTGGTCCCACAGG - Intronic
1083684628 11:64368914-64368936 CTGCGCCTCCCTGGTCCCTTTGG - Intronic
1123666649 15:22613701-22613723 CCCCGATAACCTGGTCCCATGGG - Intergenic
1124320491 15:28708274-28708296 CCCCGATAACCTGGTCCCATGGG - Intronic
1134534526 16:15015059-15015081 CCGCGAGTACCTGGGACTATAGG + Intronic
1138531207 16:57635337-57635359 CCGTGTGCACCTGGTCCCCTAGG - Intronic
1144205112 17:12974298-12974320 CCGCGCTTACCTGGTGCGCTCGG - Exonic
1158415271 18:57244825-57244847 CCCCGAGTAGCTGGTCCTATAGG + Intergenic
1163129248 19:15262099-15262121 CAGCCCGTACCTGCTCCCACTGG - Intronic
924985484 2:265319-265341 CCAGGCCTACCTGGGCCCATTGG - Intronic
935634854 2:105242434-105242456 CCGCGCCTACGTGGTCACCTTGG + Exonic
1169015406 20:2288877-2288899 CCTTGCATACCTGGCCCCATAGG + Intergenic
1180129825 21:45820310-45820332 TTGCGCCTACCTGGCCCCATGGG + Intronic
1002181654 5:177433930-177433952 CAGCGCGTCCTTGGTCTCATAGG - Exonic
1029659842 7:101952756-101952778 CGGGGCTTACCTGGTCCCAGAGG + Intronic
1194810273 X:98380342-98380364 CCGCGCGTGCCTGCAGCCATTGG + Intergenic
1195790177 X:108575907-108575929 CAGGGCCTACCTGGTCCCACTGG + Exonic