ID: 1072130247

View in Genome Browser
Species Human (GRCh38)
Location 10:92487140-92487162
Sequence GGGACAGACCTAATACATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072130247_1072130255 25 Left 1072130247 10:92487140-92487162 CCCCCATGTATTAGGTCTGTCCC 0: 1
1: 0
2: 1
3: 8
4: 121
Right 1072130255 10:92487188-92487210 CACATTACCTTAATAAGAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 155
1072130247_1072130256 26 Left 1072130247 10:92487140-92487162 CCCCCATGTATTAGGTCTGTCCC 0: 1
1: 0
2: 1
3: 8
4: 121
Right 1072130256 10:92487189-92487211 ACATTACCTTAATAAGAGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072130247 Original CRISPR GGGACAGACCTAATACATGG GGG (reversed) Intronic
904245022 1:29181591-29181613 GGGACAGACCCCATAGGTGGTGG - Intronic
904478423 1:30779039-30779061 GGGACAGAACTAGTAGGTGGTGG + Intergenic
909493994 1:76257674-76257696 GGTACAGGCCAAATAGATGGCGG - Intronic
911719643 1:101177107-101177129 GTGACAGACTTAATACCTAGGGG - Intergenic
914878727 1:151531241-151531263 GGGAAAGAGCAAAAACATGGAGG - Intronic
915146023 1:153796191-153796213 GGGACAGACCTAGAGGATGGGGG - Intergenic
916731343 1:167569679-167569701 GCCACAGAGCAAATACATGGTGG + Intergenic
917733641 1:177900855-177900877 GGGACAGAGCTTGTAGATGGAGG + Intergenic
918903955 1:190465751-190465773 GGGATAGACCTTATTCAAGGTGG - Intronic
1067702626 10:48584606-48584628 GGAACAGACGTAAGTCATGGTGG + Intronic
1072130247 10:92487140-92487162 GGGACAGACCTAATACATGGGGG - Intronic
1078040720 11:7860180-7860202 GGCAAATACCTAATGCATGGGGG + Intergenic
1080589251 11:33707337-33707359 AGGACACACATAAGACATGGGGG + Intronic
1081050822 11:38338400-38338422 GGAAAAGACCTAATGCATGCCGG + Intergenic
1081648697 11:44808355-44808377 TGGACAGACCTAGTACAGGAGGG + Intronic
1082769722 11:57197909-57197931 GGATCAGACTTAATCCATGGTGG - Intergenic
1085625421 11:78068178-78068200 GGGCCAGAGCAAATACATTGGGG - Exonic
1085704969 11:78778739-78778761 GGGACAGGCCTATGCCATGGTGG + Intronic
1086323360 11:85672830-85672852 GAGTCAGACCTTATTCATGGTGG + Intronic
1087775809 11:102255680-102255702 GGGACAGCCATACTAAATGGTGG - Intergenic
1088245307 11:107812556-107812578 GGAAAAGAGCTAATACATGCTGG + Intronic
1091084373 11:132706130-132706152 AGGAACGACCTAATACAAGGGGG + Intronic
1091673592 12:2470593-2470615 GGCACACAGCTAATAAATGGTGG - Intronic
1094231996 12:28116390-28116412 AGGATAGACCTAATATATGATGG + Intergenic
1099571377 12:84323540-84323562 CTGACAGACCTAATATAAGGTGG + Intergenic
1100152876 12:91762537-91762559 TGGACAGTCCTATTACATTGAGG + Intergenic
1101246261 12:102886619-102886641 GTGACATAACCAATACATGGAGG - Intronic
1103112428 12:118292152-118292174 TGGATAGTCATAATACATGGTGG + Intronic
1103403047 12:120656104-120656126 GGAACAGACCAGCTACATGGTGG + Intronic
1103873104 12:124105474-124105496 GAGACAGTTTTAATACATGGGGG + Intronic
1103917188 12:124381981-124382003 GGGCCAGACCTAGTGCAAGGCGG + Intronic
1110742552 13:79014889-79014911 GGGACAGGACTAATACAAAGGGG - Intergenic
1114976540 14:28107571-28107593 GCGACAGACTTAAAACATGTAGG - Intergenic
1115044028 14:28967917-28967939 GGGAAAGACATTATACAAGGGGG - Intergenic
1117206474 14:53448841-53448863 GTGACAAATCTAACACATGGAGG + Intergenic
1121567549 14:94922215-94922237 AGGAGAGACCTAATATGTGGGGG - Intergenic
1131296415 15:91153422-91153444 GTCACAGACCTAAAACGTGGTGG - Intronic
1132580364 16:681941-681963 GGCACAGACCCAACACAAGGCGG - Exonic
1137332608 16:47514178-47514200 GGGACAGAACTAATAGGTGGAGG + Intronic
1141716055 16:85727464-85727486 GCGACAGAAAAAATACATGGGGG + Intronic
1146579137 17:34021419-34021441 GGGCCAGACCTGATAACTGGTGG - Intronic
1147753807 17:42754829-42754851 GGGACAGTCCTAATGAATGGAGG + Intergenic
1148031201 17:44622458-44622480 TGGACAGAGCAAAGACATGGAGG - Intergenic
1148230450 17:45930058-45930080 GGGACAGAGCCAAAGCATGGTGG - Intronic
1151896276 17:76982907-76982929 GGGACAGACATAAAACCTTGGGG + Intergenic
1152920260 17:83063004-83063026 GGGACAGTCCTAAGGCACGGAGG - Intergenic
1153146849 18:2043073-2043095 GGGAAAGAGCTAATGCATGCTGG + Intergenic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1155537007 18:26828891-26828913 GGGACAGACCTAAACCATGCGGG + Intergenic
1155537043 18:26829101-26829123 GAGACAGACCTAAACCATGCAGG + Intergenic
1155537085 18:26829358-26829380 GAGACAGACCTAAACCATGCGGG + Intergenic
1155537115 18:26829520-26829542 GAGACAGACCTAAACCATGCAGG + Intergenic
1155537157 18:26829777-26829799 GAGACAGACCTAAACCATGCGGG + Intergenic
1157539417 18:48489118-48489140 GGGACAGAACTAAGACCTGCTGG + Intergenic
1159989178 18:74882254-74882276 GGGACAGTGCTAATTTATGGTGG + Intronic
1163468262 19:17482171-17482193 GGGACAGACCAAGGACACGGTGG + Intronic
926826048 2:16905892-16905914 GGGACAGAACTAATGGAAGGGGG + Intergenic
933465154 2:82641969-82641991 GGGACAGACCGAATTCCTGGTGG + Intergenic
936410218 2:112251695-112251717 GTCACAGAGCTAATACATGGTGG + Intronic
939225703 2:139361479-139361501 GTCACAGAACTAAAACATGGTGG + Intergenic
942207907 2:173640689-173640711 GGGACAAACTTTAAACATGGAGG - Intergenic
943376511 2:187084253-187084275 AGCTAAGACCTAATACATGGGGG + Intergenic
943629706 2:190237778-190237800 GAGAAATACCTAATACATGAGGG - Intronic
944061874 2:195578427-195578449 GGGAAAGAGCTAATGCATGCTGG + Intronic
945735797 2:213598739-213598761 GAGACAGGAATAATACATGGTGG + Intronic
946896138 2:224326329-224326351 GAGACAGACATAAAAAATGGAGG + Intergenic
946948774 2:224849857-224849879 GGGACAGGAATAATACAGGGTGG + Intronic
1174089468 20:48035519-48035541 GAGAACGAACTAATACATGGGGG + Intergenic
1174546869 20:51332245-51332267 GGAAAAGAGCTAATACATGCTGG - Intergenic
1184896573 22:47410758-47410780 GGGACTGAATTTATACATGGAGG + Intergenic
950397759 3:12746973-12746995 GAGCCAAACCTCATACATGGTGG + Intronic
950435447 3:12976528-12976550 GAGACAGACCTCATACATGAAGG + Intronic
951699215 3:25478064-25478086 TTGTCAGACCTATTACATGGGGG + Intronic
951839297 3:27016541-27016563 GGAACAGAACTAATATATGTGGG - Intergenic
952297423 3:32073592-32073614 TGGATAGACCTAATAAATGAAGG - Intronic
956455491 3:69416659-69416681 GAGAAACACCTAATACATGCAGG - Intronic
958884588 3:99711581-99711603 GGAAGTGACCTAATACCTGGGGG + Intronic
959844228 3:111014388-111014410 GTTTCAGACCTAATAAATGGAGG + Intergenic
964516216 3:157511267-157511289 GGCAAATACCTAATACATGTGGG + Intronic
965223005 3:165951969-165951991 GGAACTGACGTAATAAATGGCGG - Intergenic
970222262 4:13823429-13823451 GGCACACATCTAATACATGGAGG - Intergenic
970606272 4:17685074-17685096 GGAAAAGATCTAATACATGCTGG + Intronic
973723823 4:53752126-53752148 CGAACATAGCTAATACATGGAGG - Intronic
982757974 4:159247234-159247256 GGGACAGACCTGAAACATGGTGG - Intronic
986618962 5:9650464-9650486 GCTACAGACCTACTACATTGGGG + Intronic
987433161 5:17861487-17861509 GGGAAATGCCTGATACATGGCGG - Intergenic
990049697 5:51482346-51482368 GACAAAGACCTAATACATGCAGG + Intergenic
990732237 5:58822059-58822081 GGGAAAGACATATTACCTGGTGG - Intronic
992750396 5:79855972-79855994 GGCACAGACTTCAGACATGGTGG + Intergenic
993550730 5:89270588-89270610 GGCACAAACTTGATACATGGTGG - Intergenic
994159731 5:96543414-96543436 GAGAAATACCTAATACATGTGGG + Intronic
995329725 5:110933617-110933639 GGGACAGAGCAGATACATGCAGG + Intergenic
996067155 5:119091791-119091813 GGGACAAACCTCCTACAGGGTGG + Intronic
996373684 5:122779853-122779875 GGAAAAGACCTAATGCATGCTGG - Intronic
999831757 5:155326801-155326823 GGAACAGAGCTAATGCATGCCGG + Intergenic
1000914506 5:167064093-167064115 TGTACAGACCTAATATATTGAGG + Intergenic
1003992097 6:11496410-11496432 TTGACAGCCCTCATACATGGAGG - Intergenic
1006502236 6:34466264-34466286 GGGCCAGACCTCCTACCTGGGGG - Exonic
1008568604 6:52793283-52793305 GGGGCAGACAGAACACATGGAGG - Intronic
1008573056 6:52833285-52833307 GGGGCAGACAGAACACATGGAGG - Intronic
1012273604 6:97244758-97244780 GGGACAGAACTAATATATATGGG - Intronic
1012701423 6:102461505-102461527 GGAAAATACCTAATACATGTGGG + Intergenic
1017741826 6:157413287-157413309 GGGACAGCCCTAAAACACAGAGG + Intronic
1018153682 6:160965105-160965127 GTCACAGACCCAATAAATGGTGG - Intergenic
1018795298 6:167180584-167180606 GGGACAGAGCATATACATTGTGG - Intronic
1018821023 6:167374478-167374500 GGGACAGAGCATATACATTGTGG + Intronic
1025071887 7:55906783-55906805 TGGACCCACCTAACACATGGTGG + Intronic
1027904569 7:84162934-84162956 GGGAGAGAGCTACTACATGGAGG + Intronic
1033187973 7:139246866-139246888 GGGACACAGGCAATACATGGAGG - Intronic
1033399355 7:141007248-141007270 GTGACAGATCTAGTAAATGGTGG - Intronic
1038026413 8:23595110-23595132 GAGACAGAAATAATACAGGGTGG - Intergenic
1039180867 8:34864535-34864557 GAGACAGAAATAATATATGGTGG - Intergenic
1040853584 8:51926375-51926397 GAGACAGAAATAATACAGGGTGG + Intergenic
1041292277 8:56319273-56319295 GGCACAGCCATAAAACATGGAGG + Intronic
1044452739 8:92357189-92357211 AGGACAGACCTAATATAAAGGGG + Intergenic
1049756872 8:144314726-144314748 GGGACAGAGGAAACACATGGAGG - Exonic
1050907331 9:11021567-11021589 GGGTTAGACCTAATAAAAGGTGG + Intergenic
1051061973 9:13055361-13055383 AGGTCAGCCCTAACACATGGAGG + Intergenic
1053200147 9:36146805-36146827 CGGACAGCCCTAAGCCATGGGGG - Intronic
1053462237 9:38280019-38280041 GAGACAGAAATAATACAAGGTGG - Intergenic
1054835187 9:69669498-69669520 GAGACAGCTCTAATAAATGGTGG - Intronic
1055870231 9:80868398-80868420 AGGAGAGACCTAATTCATAGGGG - Intergenic
1057391175 9:94642611-94642633 GGGACACACTGAATACGTGGAGG + Intergenic
1058529235 9:105889395-105889417 GAGAGCGTCCTAATACATGGGGG - Intergenic
1060261755 9:122081425-122081447 GTGACAGAACTAATATGTGGTGG + Intronic
1187001897 X:15189883-15189905 GGGACTGACAAAATACATGATGG - Intergenic
1193991569 X:88314372-88314394 GGTAAATACCTAATACATGCAGG + Intergenic
1195039237 X:100999096-100999118 GGGACATTCATGATACATGGAGG - Intergenic
1195812740 X:108851932-108851954 GGAACAGACCTAATGCAGGCAGG - Intergenic
1196595214 X:117538065-117538087 GAGACAGACCTAATACAGATGGG + Intergenic
1197958270 X:131976545-131976567 GGGAAAGAGCTAATGCATGCTGG - Intergenic