ID: 1072139173

View in Genome Browser
Species Human (GRCh38)
Location 10:92574369-92574391
Sequence GCCCTCACTGGATTTATGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072139173_1072139178 0 Left 1072139173 10:92574369-92574391 CCGCTCATAAATCCAGTGAGGGC No data
Right 1072139178 10:92574392-92574414 ACACGGGGCTATGTTTTCTGAGG No data
1072139173_1072139179 24 Left 1072139173 10:92574369-92574391 CCGCTCATAAATCCAGTGAGGGC No data
Right 1072139179 10:92574416-92574438 ACCCCCACTGACTAGCGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072139173 Original CRISPR GCCCTCACTGGATTTATGAG CGG (reversed) Intergenic