ID: 1072139173 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:92574369-92574391 |
| Sequence | GCCCTCACTGGATTTATGAG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1072139173_1072139178 | 0 | Left | 1072139173 | 10:92574369-92574391 | CCGCTCATAAATCCAGTGAGGGC | No data | ||
| Right | 1072139178 | 10:92574392-92574414 | ACACGGGGCTATGTTTTCTGAGG | No data | ||||
| 1072139173_1072139179 | 24 | Left | 1072139173 | 10:92574369-92574391 | CCGCTCATAAATCCAGTGAGGGC | No data | ||
| Right | 1072139179 | 10:92574416-92574438 | ACCCCCACTGACTAGCGTGCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1072139173 | Original CRISPR | GCCCTCACTGGATTTATGAG CGG (reversed) | Intergenic | ||