ID: 1072147016

View in Genome Browser
Species Human (GRCh38)
Location 10:92650668-92650690
Sequence CAAAAATCTGATATTGATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 436}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072147014_1072147016 18 Left 1072147014 10:92650627-92650649 CCTTAGGATGGCTTGTTAACGCT 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1072147016 10:92650668-92650690 CAAAAATCTGATATTGATAAGGG 0: 1
1: 0
2: 2
3: 43
4: 436

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072147016 Original CRISPR CAAAAATCTGATATTGATAA GGG Intronic
900468355 1:2836992-2837014 AAAAAATCTGATTTCCATAACGG + Intergenic
900752350 1:4406613-4406635 CAAAGATAAGATATTGGTAAAGG - Intergenic
904955743 1:34282407-34282429 AAAAAATCTGATTTTAAAAATGG - Intergenic
905424673 1:37873662-37873684 CAATTATCTGCTCTTGATAATGG - Intronic
905954923 1:41984690-41984712 GAAAGATCTGATTTTGCTAATGG + Intronic
907890041 1:58628369-58628391 AAAATATCTGATTTAGATAAGGG + Intergenic
908018631 1:59876313-59876335 CACAACTATTATATTGATAATGG - Exonic
908082266 1:60593817-60593839 GAAAAAATTGATATTGACAAAGG - Intergenic
908719618 1:67110862-67110884 CAAAAATTTGTTATTAATTATGG + Intronic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909337848 1:74496715-74496737 ATAAAATCTGAGATTGAGAAAGG + Intronic
909752459 1:79179593-79179615 CAAAAGCCTGATAGTGATATGGG - Intergenic
909824250 1:80106524-80106546 CAATAATTTTATATTGTTAAGGG + Intergenic
910030832 1:82720653-82720675 TAATAATCTGATATTTAAAATGG - Intergenic
910050121 1:82963757-82963779 CATAAATATAATATAGATAATGG - Intergenic
910553683 1:88505617-88505639 AAAAAAATTGATATTGATAAAGG + Intergenic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
911583225 1:99659418-99659440 CAACAATATGTTATTCATAATGG + Intronic
916306002 1:163333765-163333787 CACAAATCTAATATCGATTAAGG - Intronic
917692099 1:177480018-177480040 CAAAAATCTGAAAGTGGTATGGG + Intergenic
918569883 1:185977270-185977292 CAAGAATATGATATTGAACAAGG + Intronic
918726614 1:187933686-187933708 CAAAAACTTGTTATTGAGAAAGG - Intergenic
918750951 1:188268603-188268625 CAAAAATAGGATATTGGAAATGG + Intergenic
918781446 1:188704850-188704872 CAAAAATCTGATAAAAATATAGG - Intergenic
918902369 1:190440025-190440047 CAAAAATCAGATTTTTAGAAAGG + Intronic
919349187 1:196427295-196427317 CAAAAATATAGTATTTATAAAGG + Intronic
919625866 1:199909711-199909733 AAAAAATCTGATATAGAAAAAGG + Intergenic
919962177 1:202482570-202482592 CAAAAACCTGATTTTAAAAATGG - Intronic
921679842 1:218018161-218018183 CAAAAATCTGTTGATTATAATGG + Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
923291461 1:232550087-232550109 CAAAAATCTGAAATGGATGTGGG - Intronic
1064412805 10:15122133-15122155 AAAAATTCTGATATTGAGAAAGG - Intronic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1067464215 10:46484063-46484085 AGAAAAACTGATATTGAAAAAGG + Intergenic
1067622979 10:47900591-47900613 AGAAAAACTGATATTGAAAAAGG - Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1067814475 10:49462637-49462659 CAAAAACCTGATTTAGAAAATGG + Intronic
1068233839 10:54206400-54206422 TAAAATTCTGATAGTGATAAAGG + Intronic
1068258676 10:54548308-54548330 CAAAAATCTAAAACTGTTAAAGG - Intronic
1068275434 10:54789897-54789919 CAAAAATATCACATTGAAAATGG + Intronic
1069044473 10:63727960-63727982 CAAAAATCTGATGATGATGCTGG - Intergenic
1070578564 10:77700329-77700351 CAAAAATATTATGCTGATAAAGG + Intergenic
1072147016 10:92650668-92650690 CAAAAATCTGATATTGATAAGGG + Intronic
1072185944 10:93039156-93039178 CAAAAGGCTGATATTGCTGAAGG + Intronic
1072857729 10:98967159-98967181 CAAAAAGCTGATATAGATAATGG + Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073203541 10:101755547-101755569 CAAAAAACTGGTATTGATCTTGG + Intergenic
1073670518 10:105582553-105582575 CAAGATTCTGATAATGATATTGG + Intergenic
1073870095 10:107853454-107853476 GAAAAATCTGAGATTCAGAAAGG - Intergenic
1074079304 10:110155018-110155040 CTAAAATCAGATAATGGTAATGG + Intergenic
1076359575 10:129877862-129877884 CAAAAAGATGATATTTATTAGGG + Intronic
1076645382 10:131950564-131950586 CAAGAATCTGCTTGTGATAAAGG + Intronic
1076918534 10:133439428-133439450 CCAAAATGTGATATGGAAAATGG - Intergenic
1078346369 11:10553267-10553289 CTAATATCAGATATTAATAACGG + Intergenic
1078694326 11:13614924-13614946 CAAAAAACAGATGTTGATGAGGG - Intergenic
1079707056 11:23634102-23634124 CAAAAATATGCAATTGGTAAAGG + Intergenic
1079942335 11:26697128-26697150 CAACAATCTGATGATGATGATGG - Intronic
1080071705 11:28096791-28096813 CAAAAATAAGATATTAATAATGG + Intronic
1080148018 11:29012074-29012096 AAAAAATCTAATAGTAATAAAGG - Intergenic
1081014247 11:37856349-37856371 CAAAAATCTGATTGTTAAAAAGG - Intergenic
1082925859 11:58546512-58546534 CAGAATTCTGAGATTGAAAAAGG - Intronic
1086024684 11:82276369-82276391 CAAAAATAGGATATTTAAAAAGG - Intergenic
1086928326 11:92665339-92665361 CAAAAATCTGTTATTTTTACTGG - Intronic
1087203482 11:95369680-95369702 CAAACATCTGATATTGGATAAGG + Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088286632 11:108196250-108196272 CACACATCTGATTTTGACAAAGG - Intronic
1088563874 11:111146877-111146899 TAAAAAGTTGATATTGATATAGG + Intergenic
1088636828 11:111829515-111829537 AAACAATGTGATATTGATGATGG - Intronic
1088840754 11:113625581-113625603 CAGTAATCTGATATTGTCAAAGG + Intergenic
1089121667 11:116139956-116139978 CAACAATCTGAAATTAATATTGG + Intergenic
1090603308 11:128394813-128394835 CATGAAGCTTATATTGATAAGGG - Intergenic
1092367115 12:7885692-7885714 CAAAAATCAGAGATTCATAAAGG + Intronic
1093144340 12:15546204-15546226 CAAAAATCTGCACTTAATAAAGG - Intronic
1093678279 12:21969595-21969617 CAAAATTCTGATTTAGAAAATGG - Intergenic
1093713191 12:22351281-22351303 AAAGAATGTGATATTGAAAATGG - Intronic
1093738140 12:22648158-22648180 TACCACTCTGATATTGATAATGG - Intronic
1093947808 12:25130183-25130205 CAAATACCTGCTATTGATAAGGG - Intronic
1095227026 12:39689525-39689547 CAATTATCTGCTATTCATAAAGG - Intronic
1095331689 12:40973168-40973190 TTAACCTCTGATATTGATAAAGG - Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1096565490 12:52474349-52474371 AAAAAATTTAACATTGATAAGGG - Intergenic
1096714258 12:53481902-53481924 CAAAAAGCAGATATTGAACAGGG - Intronic
1097650828 12:62295466-62295488 CAAAAATGTAAAATTTATAATGG + Intronic
1097698497 12:62797644-62797666 CAAAAACCTAATATTGAGAGGGG + Intronic
1098956054 12:76690963-76690985 CAAAAATCAGGTCTTGATTATGG + Intergenic
1099065137 12:77967200-77967222 CAATAGGCTGATATTAATAAAGG - Intronic
1099182905 12:79488059-79488081 TAAACATCTGGTATTGATATGGG - Intergenic
1099251232 12:80257494-80257516 CAAAAGTCTGAACTTGGTAATGG + Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099683473 12:85857272-85857294 CAAAATTCTGAGATTGATGGTGG - Intergenic
1101094740 12:101326318-101326340 CATAATTGTGATATTGAGAAGGG - Intronic
1101277143 12:103215351-103215373 TAAAAATCTGATAATGACACTGG + Intergenic
1103071609 12:117948529-117948551 CAAAAATGTGATATTGACAAAGG + Intronic
1104275394 12:127322487-127322509 CAAAGATATGATATTGAATATGG - Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1106739864 13:32628848-32628870 AAAAAATCTGACATCGAAAAGGG - Intronic
1108015354 13:46069417-46069439 CAAAAATCAGATATTAGTGATGG - Intronic
1108679079 13:52763869-52763891 CAAAAATCTAATAGAGATCAGGG + Intergenic
1109182014 13:59225062-59225084 TGAAAATCTGACATTGATAATGG - Intergenic
1110591670 13:77269635-77269657 AAAAAATGTGCTAATGATAAAGG + Intronic
1110971100 13:81762464-81762486 CATAACTCTTATATTGAGAAGGG + Intergenic
1111046348 13:82819043-82819065 CAATAATCTGATTTGTATAATGG - Intergenic
1111650933 13:91090338-91090360 TAAAAATCTTCTATTGATAGGGG - Intergenic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1113043553 13:106129600-106129622 CACAAATGTGATAATAATAAAGG - Intergenic
1113234674 13:108257205-108257227 CAAAAAAATGCTTTTGATAAAGG + Intronic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1116294137 14:43084162-43084184 TGAAAATGTTATATTGATAATGG - Intergenic
1116626700 14:47274143-47274165 CTAAAATCTGATTTTGGTGATGG - Intronic
1117623641 14:57613334-57613356 CTGAAATTTGTTATTGATAAAGG + Intronic
1117937580 14:60924427-60924449 CAAAACTGTGATATAGATTAAGG + Intronic
1120283331 14:82466036-82466058 CAATAATCTAATATTGTCAATGG - Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123501130 15:20881915-20881937 GAAAAATAAAATATTGATAAAGG - Intergenic
1123558382 15:21455620-21455642 GAAAAATAAAATATTGATAAAGG - Intergenic
1123594613 15:21892895-21892917 GAAAAATAAAATATTGATAAAGG - Intergenic
1123872185 15:24587884-24587906 GAAAACTCAGAAATTGATAAAGG - Intergenic
1124361707 15:29041742-29041764 AAAAAACTAGATATTGATAATGG + Intronic
1124950607 15:34316277-34316299 AAAAAATCTTAAATTGATCATGG - Intronic
1125377814 15:39051810-39051832 CAAAAAACTGAAAATGAGAAGGG + Intergenic
1125486049 15:40111571-40111593 CAAGAATGGGATATTGATATGGG + Intergenic
1126126601 15:45299613-45299635 CTAATATCAGCTATTGATAATGG - Intergenic
1126305502 15:47251153-47251175 CAGAAATCTGTTTTTCATAAAGG - Intronic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127140955 15:55976385-55976407 CAATAATCTGATATTAAAATGGG + Intronic
1128198731 15:65785197-65785219 CAAAGATCAGAAATTTATAAAGG + Intronic
1128949931 15:71868095-71868117 CTAAAATCAGATATTGACAAGGG + Intronic
1129920979 15:79318931-79318953 CAGACATTTGATATTGAAAAAGG - Intronic
1130264117 15:82383707-82383729 AAAAAATCTGATTTTTTTAAGGG - Intergenic
1130647248 15:85739745-85739767 CAAATATCTGAAAATGTTAAAGG - Intronic
1130948017 15:88563728-88563750 GGAAAATCTGCTAGTGATAAAGG + Intergenic
1131702403 15:94952641-94952663 CAAAAAACTGCTAATTATAAAGG - Intergenic
1202966732 15_KI270727v1_random:182770-182792 GAAAAATAAAATATTGATAAAGG - Intergenic
1134868766 16:17632621-17632643 CAGAAATCTTATATGGGTAAGGG - Intergenic
1138367799 16:56496541-56496563 GAAAAATCTGATAAGCATAATGG - Intronic
1138805832 16:60087180-60087202 CAAAAATCTGAAAGTGATTTTGG - Intergenic
1139028492 16:62849905-62849927 CAAAAAGTTGATATTGATCGAGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1139128923 16:64116550-64116572 CTATAATCTGATATTGATATAGG - Intergenic
1142836175 17:2589027-2589049 CAAAAGTCTGTTTATGATAAGGG - Intergenic
1144141578 17:12354297-12354319 CAGAAATATGATATTTCTAAAGG - Intergenic
1148527947 17:48360443-48360465 CTAAAAGGTGATATCGATAAGGG - Intronic
1151639512 17:75379730-75379752 CAAAGATCTGAAATTAATAGTGG - Intronic
1151959066 17:77395798-77395820 CAAAAATGTGATTTTAATGATGG + Intronic
1153182715 18:2453685-2453707 CAAAAATCTCATCTTGCTTAAGG + Intergenic
1155983090 18:32201040-32201062 CAAAGATCTTATCTTGGTAAAGG + Intronic
1156174296 18:34524388-34524410 CAAAAATCTGTCATTTTTAACGG - Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156695944 18:39767831-39767853 CAAGAGTGTGATATTGATGAAGG + Intergenic
1156721636 18:40077298-40077320 AAATAATCTCATGTTGATAAGGG + Intergenic
1157530037 18:48412431-48412453 GAAAAATCTGATATCAATAGTGG + Intergenic
1158087417 18:53668675-53668697 GAAAAATTTGATTTTGAAAAAGG - Intergenic
1159183367 18:64939715-64939737 CATAAATATGTTGTTGATAAAGG + Intergenic
1159451072 18:68603001-68603023 AAAAAAACTGTTATTGATACAGG - Intergenic
1159469313 18:68830246-68830268 CACAAGCCTGATATTGTTAAAGG - Intronic
1163051338 19:14686412-14686434 CAATAAAGTAATATTGATAATGG - Intronic
1164600009 19:29554981-29555003 CAATGATCTAATATTGACAATGG - Intronic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1166604504 19:44128445-44128467 CAAAAATCTCTTATTTATAAGGG + Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
924989891 2:304603-304625 CATAAATCTGTTAATCATAAGGG - Intergenic
925205353 2:2001157-2001179 AAAAAAACTAATAGTGATAAAGG - Intronic
925206503 2:2011618-2011640 TAAAAATCATATATTGATAAGGG + Intronic
926225296 2:10962708-10962730 CCAGAATCAGATATTGATCATGG - Intergenic
926486510 2:13467047-13467069 CTAATATCTGATGTTCATAATGG + Intergenic
927140507 2:20127171-20127193 CAAAATTCTGATGGTGTTAATGG + Intergenic
927547765 2:23969988-23970010 CAAAAATGTGTTATTTTTAAAGG - Intronic
927619588 2:24638829-24638851 CAACAATCTGATTTTAAAAATGG - Intronic
929942968 2:46348789-46348811 CAAAAATCTGAAATTTGAAATGG + Intronic
929986376 2:46736969-46736991 CAAAAATCTGAAATTCAAAATGG - Intronic
930278810 2:49344812-49344834 TAAAAAGCTGAAATTGCTAAGGG - Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
931109562 2:59095956-59095978 CAAATATTTCATATTTATAATGG + Intergenic
931942742 2:67270993-67271015 TATAAATGTGATGTTGATAAAGG - Intergenic
933245815 2:79973626-79973648 CCAAAATCTGATATTTATTCAGG + Intronic
934102945 2:88670426-88670448 CCAAAACCTGACATTGATATTGG + Intergenic
934899494 2:98146704-98146726 CAAAAATAACATACTGATAAGGG - Intronic
935028011 2:99296085-99296107 CAAAATTCTCCTTTTGATAATGG - Intronic
935932507 2:108143313-108143335 AGAAATTCTGATATAGATAAAGG + Intergenic
936088422 2:109485640-109485662 TAGAAATCTGATATTTAAAAAGG - Intronic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
939355004 2:141089928-141089950 CAAGAATATGATAGTGAAAAGGG + Intronic
939781018 2:146447840-146447862 CACAAAACTGATTTTGACAAAGG - Intergenic
939970606 2:148655043-148655065 CAAAAGTATGGTATTGATGAGGG + Intronic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940961368 2:159790086-159790108 CAAATGTCTGATATGGATGATGG - Intronic
941058891 2:160822558-160822580 AAAAAATCTGATTTTAACAAGGG - Intergenic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
942139462 2:172963384-172963406 CAAAGATCTCATATGGTTAAAGG + Intronic
942549462 2:177099891-177099913 CACAAATCAGTTACTGATAAAGG + Intergenic
942832025 2:180248388-180248410 GAAAAAGCTGAGATTTATAAGGG - Intergenic
942944975 2:181662268-181662290 TAAATATCTGAAATTAATAAAGG - Intronic
942971907 2:181967255-181967277 AAAAAATATGAGATTAATAAAGG - Intronic
943427187 2:187751244-187751266 CAAAAATATAGTATTGAAAAGGG - Intergenic
943569081 2:189551236-189551258 ACAAAATCTGATGTTGACAAAGG + Intergenic
944005994 2:194906572-194906594 CATATAGGTGATATTGATAAAGG - Intergenic
944300402 2:198117894-198117916 CTAAAATGTACTATTGATAAAGG - Intronic
944990077 2:205225432-205225454 TAAAAATCTGATTTTAAAAATGG - Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
945796263 2:214368146-214368168 CAAAAATATGCTAATGACAAGGG - Intronic
945857456 2:215085549-215085571 CAAAAATCTCAATTTTATAATGG + Intronic
946510767 2:220353650-220353672 CAAAACTCTGATAAAGAGAAGGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
1169637833 20:7713720-7713742 GAAACATTTTATATTGATAAGGG + Intergenic
1171248333 20:23631157-23631179 CAAAAATATTATATTTAAAATGG + Intronic
1173097442 20:40049462-40049484 CAAAGATCTGGCATTGTTAAAGG + Intergenic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1174444542 20:50581814-50581836 CAAAAAGCTGCTTTTTATAAAGG - Intronic
1174960063 20:55146109-55146131 CTAAAATTAGATTTTGATAATGG + Intergenic
1175288789 20:57858616-57858638 CAAATATCTGATTTCGAAAATGG - Intergenic
1175812825 20:61868055-61868077 CACTAATCGGATATTGATCAGGG - Intronic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177450847 21:21263504-21263526 TAAAAATCTAAAATTCATAATGG + Intronic
1177604557 21:23360804-23360826 CAAAACGCTGATAGTGATACGGG - Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1179330090 21:40391807-40391829 CAAAAATCTCATTTTGAGTATGG + Intronic
1182033246 22:27176646-27176668 CAAAAATATCATATGGACAAGGG - Intergenic
1182989829 22:34756611-34756633 CAAATCTCTGGTATTGACAAGGG - Intergenic
1183542015 22:38434969-38434991 GCAAAAACTGATGTTGATAATGG + Intronic
1183763906 22:39852369-39852391 CAATCATCTGATATTAATGATGG + Intronic
949126069 3:446428-446450 CCAAAATCTGTTATTAATCAGGG + Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951092649 3:18592729-18592751 TTAAAATCTGATTTTGATTATGG + Intergenic
951420127 3:22474081-22474103 CAAAACTCTCATTTTGAAAATGG - Intergenic
951681637 3:25301001-25301023 CAAAAATCTCTGATTTATAATGG + Intronic
951769195 3:26236432-26236454 TTAAAATCTTATTTTGATAAAGG + Intergenic
952697336 3:36282664-36282686 GAAAAATCTGAAACTGAAAAAGG - Intergenic
953098715 3:39805316-39805338 CAAAGAGCTCTTATTGATAAAGG + Intergenic
953159190 3:40402616-40402638 CAATAATATGATAATAATAATGG - Intronic
953528108 3:43712337-43712359 CAACACTCTGACATGGATAAGGG - Intronic
955477534 3:59353609-59353631 GAATAAACTGATATTTATAAAGG - Intergenic
956756257 3:72390348-72390370 GAAAAATCAGATATTAATAAAGG + Intronic
957127187 3:76176770-76176792 CAAAAACCCGTTATTAATAAAGG + Intronic
957289170 3:78255492-78255514 ATAAAACCTGAGATTGATAAGGG + Intergenic
957425721 3:80036549-80036571 CATAAAGCAGACATTGATAAGGG + Intergenic
957941169 3:87006081-87006103 CAAAAATCAGCTATGGGTAAAGG - Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958608234 3:96388344-96388366 CAAAAATAAGATATTGGGAAAGG - Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959235827 3:103720148-103720170 CAAAAATATGAAAATAATAATGG - Intergenic
959362567 3:105411982-105412004 AAAAAATCTCATACTGATAAGGG + Intronic
959518791 3:107302236-107302258 AAAAAATCTGTTATTAATAATGG + Intergenic
959801965 3:110505633-110505655 AAAAACTTAGATATTGATAAGGG + Intergenic
962279230 3:134037720-134037742 GAAAAATATGATAGTAATAATGG - Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963170892 3:142250259-142250281 CAAAAATCTGATTTTAAAATGGG + Intergenic
963287995 3:143455286-143455308 AAAAAATGTGATATTGACAAAGG - Intronic
963346731 3:144103855-144103877 ATAAAATCTGATATTGACTATGG + Intergenic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
963541695 3:146598984-146599006 CAGAGATTTGATTTTGATAAAGG + Intronic
963613977 3:147511213-147511235 AGAATATCTGATCTTGATAATGG + Intergenic
964398090 3:156268693-156268715 TAATAATCTGATTTTGAAAATGG - Intronic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
965275318 3:166675786-166675808 CTACAATTTGGTATTGATAACGG - Intergenic
965319707 3:167237836-167237858 CAAAATTCTTATATTGTAAAAGG + Intergenic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
966424051 3:179762011-179762033 CTAAAATTTGATAGTGGTAATGG - Intronic
966625612 3:182013222-182013244 CTAAAATTAGATAGTGATAATGG - Intergenic
966672427 3:182542277-182542299 CAAAAATATGCTAATGATTATGG + Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
966996800 3:185290326-185290348 CTAAAATATTATAGTGATAAAGG - Intronic
967454710 3:189671196-189671218 CAAAAATATGATTTTAATAATGG + Intronic
967677778 3:192320245-192320267 AAAAAATCATATAATGATAAAGG + Intronic
967727720 3:192877455-192877477 AAAAATTCAGATATTGTTAAAGG - Intronic
967788774 3:193524961-193524983 AAAAAATCAGATAGAGATAAAGG - Intronic
968241473 3:197091644-197091666 CAAAAATATGATTTTGAAAATGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970097570 4:12481088-12481110 TAATAATCTGATATTAAAAATGG - Intergenic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970565606 4:17329473-17329495 CAAATATCTGACACTGAAAAAGG + Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
970662885 4:18305879-18305901 TAAATATATGATATTTATAAGGG + Intergenic
971637620 4:29082701-29082723 CCAAAATCTGATTGTGATTATGG - Intergenic
971892144 4:32538588-32538610 CAAAAATGTGATATTAATTTAGG - Intergenic
972916625 4:43888910-43888932 CAAAAATGTGATAATAGTAATGG - Intergenic
973001429 4:44956334-44956356 CCAAGATCTGATATCCATAATGG + Intergenic
973023684 4:45238306-45238328 TTAAAATCTGGTATTGATGAGGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
973763781 4:54145162-54145184 TAAAAATCTGACACTGCTAAAGG - Intronic
974668522 4:64997300-64997322 CCAAAATTTGATTTTTATAATGG - Intergenic
974669413 4:65009705-65009727 TCCAAATCTGATATTTATAAAGG - Intergenic
974702562 4:65470919-65470941 CAAAATTCAGATATTGTTATAGG - Intronic
974724105 4:65777061-65777083 CAAAATTCTGATAATGATACGGG + Intergenic
975164793 4:71166042-71166064 GAAAAATTTCCTATTGATAATGG + Intergenic
975201760 4:71598182-71598204 CAAAAATTTAAAATTGAAAAAGG - Intergenic
975432711 4:74313973-74313995 CAAAAATATAATAATAATAAGGG + Intronic
975766059 4:77668824-77668846 GAAAAATATGTTATTGAAAATGG - Intergenic
975964797 4:79959226-79959248 CAAAAAAATGTTATTTATAAGGG - Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977486469 4:97653670-97653692 CAAAATTATGTTATTGATAATGG + Intronic
979009788 4:115353368-115353390 AAAAAATCATATACTGATAAAGG - Intergenic
979509941 4:121541108-121541130 CAAAAATCTGATTTTTAAAATGG + Intergenic
980310524 4:131124543-131124565 CATAAAGCTAACATTGATAAAGG - Intergenic
980597643 4:134975489-134975511 GAGAAATCTGAAATTTATAAAGG - Intergenic
980966820 4:139529669-139529691 CCAAAATTTAATATTGAGAAGGG - Intronic
981231032 4:142356038-142356060 CAAATCTTTCATATTGATAAGGG + Intronic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981438664 4:144756887-144756909 TAAAAATCTAATATTGTAAATGG - Intergenic
981586283 4:146306387-146306409 TAAAAATGTTATCTTGATAAAGG - Intronic
982009318 4:151091631-151091653 CAAAAATCTGAGTAAGATAATGG - Intergenic
982814112 4:159864065-159864087 TAAAAATCAGATATTCATAAAGG + Intergenic
982915701 4:161205727-161205749 CAAAACACTTATATTCATAATGG + Intergenic
983338244 4:166422937-166422959 CAATAATCTGTTGTTAATAATGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
983988012 4:174083609-174083631 GAAAATTATAATATTGATAAAGG - Intergenic
984010286 4:174362729-174362751 CAAATATATGATATTAATAATGG + Intergenic
984113976 4:175655626-175655648 CAAAAAACAGAAATTAATAAAGG - Intronic
984683236 4:182635488-182635510 TAAAAATCTGAAATTTTTAAGGG + Intronic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986165356 5:5267868-5267890 CAAAGATCTGATTCTGATATGGG - Intronic
987868469 5:23578044-23578066 AAAAAATCTGAACTTGAAAAAGG - Intergenic
988011747 5:25496804-25496826 CAAAAAACTGACATTTATAATGG + Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988437897 5:31196826-31196848 AGAAAATCTTATATTGATGATGG - Intronic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
990498836 5:56374766-56374788 CAAAAATATGAAATGCATAAGGG - Intergenic
991937998 5:71821435-71821457 CAAAAATCTGATTTTAAAATGGG - Intergenic
992457382 5:76928184-76928206 CAAAAAGCTGTAATTTATAAAGG - Intergenic
992599307 5:78381919-78381941 TAAAAATCTGAAATGGATAAAGG + Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993514147 5:88809190-88809212 CATACATCTTATGTTGATAATGG + Intronic
994099056 5:95874879-95874901 TAAAAATCTGAAATTTGTAATGG - Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994499141 5:100552033-100552055 CAAGAATCAGATACTAATAAGGG - Intronic
994614237 5:102083295-102083317 CAAAAATAAGCAATTGATAAAGG + Intergenic
994755051 5:103784244-103784266 CAATAATTTAATTTTGATAAAGG + Intergenic
994849569 5:105036671-105036693 CAAAACCCTGATAGTGATATGGG - Intergenic
995466765 5:112457867-112457889 CAAAATAAGGATATTGATAAAGG + Intergenic
995558053 5:113350848-113350870 CAATAATCTGATTTTAAAAATGG + Intronic
996832713 5:127757364-127757386 TAAAAATATAATATTGAAAATGG - Intergenic
996904074 5:128577655-128577677 CAACAATCTGATATTTTAAATGG - Intronic
998677170 5:144422691-144422713 CAAAAATTGGATATTTATTAAGG + Intronic
999956308 5:156706471-156706493 CAGAAATGTGACATTGAAAATGG - Intronic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000655698 5:163875641-163875663 CAAACATCTGAAATAAATAAGGG - Intergenic
1000707855 5:164533824-164533846 CAGGAATCTGATAGTCATAAAGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1005154995 6:22794371-22794393 GCCAAATCTGATATTGAGAAAGG + Intergenic
1005677544 6:28170883-28170905 GGAAAATCTGGTATTGATGAAGG - Intergenic
1005797053 6:29375529-29375551 AACAAATCAGATATAGATAAAGG + Intronic
1006693886 6:35914321-35914343 CAACAATCTAATATTAAAAATGG + Intronic
1006928826 6:37675079-37675101 CAAAAAACTGTTAATGATGAGGG + Intronic
1006993967 6:38240435-38240457 CAAAAGTCTGATATTTATCTAGG - Intronic
1008288943 6:49688745-49688767 AAAAAGTCTCATATTGATTAAGG + Intergenic
1008324986 6:50167820-50167842 CAAAAATACGATAGTGAAAAGGG - Intergenic
1008495565 6:52130032-52130054 CAAAAATATCATATTGACAAAGG + Intergenic
1008696286 6:54042065-54042087 GAAGAACCTGATATTGTTAAGGG - Intronic
1008777105 6:55053243-55053265 CAAAAATCTGGTGTTAATGATGG - Intergenic
1009469231 6:64011013-64011035 GAAAGATCTGATATAGATATAGG - Intronic
1009710119 6:67307579-67307601 CACAACGCTGATAGTGATAATGG + Intergenic
1009762857 6:68030402-68030424 GAAAAATCAGATATTCATTAGGG - Intergenic
1009802540 6:68558154-68558176 CAAAACATTTATATTGATAAAGG + Intergenic
1010163813 6:72891834-72891856 CAAAAATCTGATAGTAATCTAGG + Intronic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1011254304 6:85405355-85405377 CAAACATCAGTTATTGTTAAGGG + Intergenic
1011372607 6:86653430-86653452 CAAAAGTCTAATTTTTATAAAGG + Intergenic
1011612310 6:89165280-89165302 CAAAAATTTGATAGTTTTAAAGG - Exonic
1011665790 6:89631829-89631851 CAAAAATCTCAAATTCAGAAAGG - Intronic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012245002 6:96916259-96916281 CAAAACTCAGATATTGTTATAGG + Intergenic
1012408166 6:98924605-98924627 CAAAAATCTGATTTTAATTAAGG + Intronic
1012622594 6:101364535-101364557 TAAACATCTGTTATTGTTAATGG - Intergenic
1012698860 6:102426283-102426305 GAAAAATCTGAAACTGATGATGG - Intergenic
1013534833 6:111054383-111054405 CAAAACTCTGATTTTGTTGAAGG + Intergenic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014471057 6:121815418-121815440 TAAAAATCTGAAATTCAAAATGG - Intergenic
1014865486 6:126524250-126524272 CAAAAGTCTGATGTTGATTGAGG - Intergenic
1015182713 6:130378195-130378217 CATGAAAGTGATATTGATAAAGG - Intronic
1015742221 6:136468967-136468989 CAAAAAACTGTTTTTGCTAAGGG - Intronic
1016195184 6:141327440-141327462 CAAAAATACGCTATTGAAAAAGG + Intergenic
1017223957 6:151998418-151998440 CACAAAACTGATATTCAAAAAGG - Intronic
1017424785 6:154309257-154309279 CAAATTTGTGATATTGATAAAGG - Intronic
1018381821 6:163264777-163264799 TAAACACCTGAAATTGATAAGGG + Intronic
1018513527 6:164552974-164552996 CAAAAATCTGTTATTTTAAATGG + Intergenic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1019895411 7:3978761-3978783 GAAAAATCTCATATTGCCAAAGG + Intronic
1021436101 7:20617659-20617681 CAAAAATCGCATTTTTATAATGG + Intronic
1021505762 7:21383112-21383134 CAATACTCAGATATTCATAATGG - Intergenic
1022261488 7:28709309-28709331 AAAAAATCAGATTTTGAAAATGG + Intronic
1023235013 7:38076399-38076421 CAATGATCTGATACTGTTAATGG + Intergenic
1024400239 7:48916074-48916096 GAAAAAAGTGATATTGACAATGG - Intergenic
1024739445 7:52338343-52338365 CAAAACTCTGATACTGGTCACGG - Intergenic
1025837367 7:65107009-65107031 TAAATATCTAATATTAATAACGG - Intergenic
1026095471 7:67343092-67343114 CACAAAACTGATATTGATACTGG - Intergenic
1027342188 7:77221393-77221415 CATAAATTTGATATTTATCATGG - Intronic
1027648437 7:80834646-80834668 CAAAAATGTGAACTTGATAAAGG + Intronic
1027753558 7:82182346-82182368 CAACAATCTGATAGTGAGATGGG - Intronic
1028157060 7:87442243-87442265 GAAAAATCTGATATTACTATGGG - Intronic
1028435299 7:90796236-90796258 CAAAAATCTGATATTCAGATAGG + Intronic
1029434923 7:100558304-100558326 CAAAATTTTTAGATTGATAATGG + Intronic
1030186097 7:106763745-106763767 CAACAATCTGATTCTAATAAAGG + Intergenic
1030542077 7:110843727-110843749 GGAAAATGTGATATGGATAAGGG + Intronic
1030689048 7:112514124-112514146 CAAAACTCTGATAGAGATAAAGG + Intergenic
1031197763 7:118638625-118638647 CAAAAATTTGATCCTGGTAAAGG - Intergenic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031689838 7:124773963-124773985 CAAAACTCTGATATCGTTTAGGG - Intergenic
1031811221 7:126371658-126371680 CAACTATCTGATATTCAAAAAGG + Intergenic
1031862679 7:126999552-126999574 CAATAATCTGATGTTAAAAAGGG + Intronic
1032510994 7:132472395-132472417 TAAAAATATGATAATCATAAGGG - Intronic
1033263712 7:139866373-139866395 CATAAAAATGATATTTATAAAGG + Intronic
1033985452 7:147220208-147220230 GGAAAATCTCATATTGATAAAGG - Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1034537307 7:151733517-151733539 TAAAAATCTGGTTTTGCTAATGG - Intronic
1036983557 8:13499248-13499270 CCAAAATCTGTTTTTAATAATGG + Exonic
1037005438 8:13773984-13774006 AAATAATCAGAAATTGATAATGG + Intergenic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1039084714 8:33768407-33768429 CTAAAATTAGATAGTGATAATGG + Intergenic
1039220471 8:35325068-35325090 CAAAAAACTGAAATTGGAAATGG + Intronic
1039413312 8:37373767-37373789 GAAAAGTCTGTTATTGATATAGG - Intergenic
1042818695 8:72906740-72906762 CAAAACTGTGATATTTATAATGG - Intronic
1042917241 8:73887638-73887660 CAACAATCTGATTTTTAAAATGG + Intergenic
1043588768 8:81801860-81801882 GAAAAATTTTATGTTGATAAAGG - Intronic
1043746488 8:83879192-83879214 CATTAATCTAATATTGACAATGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044274247 8:90281852-90281874 CAAAAAACTGATATTAAGCAAGG + Intergenic
1044382672 8:91552806-91552828 AAAAAATGTGTTATTGATATAGG + Intergenic
1044904935 8:96990691-96990713 CAAAACTATAATATTGGTAAGGG - Intronic
1044959637 8:97517824-97517846 CAAAACTTTGAAAATGATAAAGG + Intergenic
1045120748 8:99031656-99031678 GAAAATGCTGATATTGATGACGG - Intronic
1045187416 8:99853187-99853209 TAAAAATCTGGTGTTGATAAGGG + Intronic
1045229237 8:100285619-100285641 AAAAATTCTGACAATGATAAAGG - Intronic
1045719475 8:105091307-105091329 CAAGAATGTCATATTGCTAAGGG + Intronic
1045812308 8:106236751-106236773 AAAAAATTTTATATTTATAAAGG + Intergenic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046516058 8:115262342-115262364 CAAAAATCAAATATTTAAAATGG + Intergenic
1046788047 8:118289251-118289273 GAAAAATCTCATATTGGCAAGGG - Intronic
1046853027 8:118997118-118997140 CAAAAATCTGATTTTAAAATGGG - Intronic
1047133929 8:122053919-122053941 TAATAATCTAATATTGACAATGG - Intergenic
1047535522 8:125716041-125716063 CAAATATATCATAGTGATAATGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1052527797 9:29641941-29641963 CAAAATTGTGATATTGGTAGAGG + Intergenic
1052912774 9:33898479-33898501 AAAATATTTTATATTGATAATGG + Intronic
1052993147 9:34534067-34534089 TAAAATTCTGGTATTGATTATGG - Intergenic
1053634192 9:39978400-39978422 TAAAAATCTTAAAATGATAAAGG - Intergenic
1054209695 9:62272297-62272319 TAAAAATCTTAAAATGATAAAGG + Intergenic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1058184148 9:101834359-101834381 CAATAATCTGATATTCAGAGTGG + Intergenic
1059521877 9:114950419-114950441 CAAAAAAATGATAATAATAAAGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059614855 9:115938388-115938410 TAAAAATATTCTATTGATAAAGG - Intergenic
1059719257 9:116943456-116943478 CTAAAATTAGATATTGGTAATGG + Intronic
1059847810 9:118300970-118300992 CCAAATTCTGATACTGATACTGG - Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1186460356 X:9743591-9743613 GAAAAATCGGATCTTGATCACGG + Exonic
1186938716 X:14480019-14480041 CAAAAAACAGATATTGGTGAGGG - Intergenic
1187228946 X:17402706-17402728 CTAAAATTAGATAGTGATAATGG + Intronic
1187725143 X:22194605-22194627 CATAAATCAGAAAATGATAATGG - Intronic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188656957 X:32709316-32709338 CACAAATATGATGATGATAAGGG + Intronic
1188971459 X:36621502-36621524 CAAACATCTGATATGGGCAATGG - Intergenic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1190480019 X:50867640-50867662 CCAACATATGATAGTGATAAAGG + Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193623899 X:83793354-83793376 CAAAAATCTGATTTTAAAATGGG + Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194562031 X:95433519-95433541 GAAAAATCTGATTTTAAAAATGG + Intergenic
1194844338 X:98785293-98785315 AAAAAATATGATGTTTATAAAGG - Intergenic
1195287553 X:103399826-103399848 AAAAAATTTGATTTGGATAATGG - Intergenic
1195315522 X:103673905-103673927 CAATAATCTAATATTTAGAAAGG + Intergenic
1196362805 X:114886085-114886107 CAAAAATTTTATAATGGTAAAGG - Intronic
1197296691 X:124727870-124727892 CAAAAAACTGAAATTCAGAAAGG + Intronic
1197494224 X:127157344-127157366 CAAAAATCGGTTGTTAATAAAGG - Intergenic
1198013501 X:132584687-132584709 AAATAATTTGATATTTATAAAGG + Intergenic
1199156728 X:144557840-144557862 CATTAATCTGATAAAGATAATGG + Intergenic
1199424040 X:147680630-147680652 CAAATATCTTATTTTCATAAGGG - Intergenic
1199863474 X:151822433-151822455 CAAAATTCTAATATTTTTAAGGG + Intergenic
1199904906 X:152215897-152215919 AAAAAATCTGATTTTAAAAATGG + Intronic
1200014962 X:153153368-153153390 CAAGAATCTGAAATTGTTGAGGG + Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1202297315 Y:23373485-23373507 CAAAAACCTGATTTTAAAAATGG - Intergenic
1202573492 Y:26297112-26297134 CAAAAACCTGATTTTAAAAATGG + Intergenic